Фрагмент списка для редактирования
Содержание
Корейский филиал
Китайский филиал
Французский филиал
Польский филиал
Испанский филиал
Тайский филиал
Японский филиал
Немецкий филиал
Итальянский филиал
Украинский филиал
Португальский филиал
Чешский филиал
Традиционный Китайский филиал
Вьетнамский филиал
Корейский филиал
- Codename: scka - Defense mechanism
- Codename: L.H. Sein - By people
- SCP-002-KO - Xianess' fountain
- SCP-003-KO - Farmhouse
- SCP-004-KO - Eraser Phenomenon
- SCP-005-KO - Mush-Room
- SCP-006-KO - Killer Bed
- SCP-010-KO - Honest Scam Calls
- SCP-011-KO - The Sleeping Giant
- SCP-014-KO - Ask Anything
- SCP-021-KO - The sage's book
- SCP-022-KO - The magnifying glass
- SCP-033-KO - Print Foundation Documents With Caution
- SCP-034-KO - Wolf Flower
- SCP-048-KO - Science Club
- SCP-049-KO - The Black Parade
- SCP-050-KO - About SCP-050-KO
- SCP-056-KO - [ WARNING: DO NOT READ THIS PAGE! ]
- SCP-064-KO - Seoul Cinematic Production
- SCP-072-KO - Absolute Taste
- SCP-077-KO - The Bermuda Triangle Underwear
- SCP-079-KO - Containment-longing Shuttles
- SCP-086-KO - Knives for Vegans
- SCP-111-KO - A Small Error
- SCP-112-KO - "Dog" Soju
- SCP-113-KO - Eternal Thursday
- SCP-114-KO - LED Fen Fire Flies
- SCP-115-KO - "Meaningless" Regular Polyhedron
- SCP-118-KO - The Savior of All
- SCP-132-KO - Bawling Bamboo
- SCP-137-KO - The Bad Land
- SCP-149-KO - CC BY-NC-ND
- SCP-153-KO - Read me before read below
- SCP-154-KO - Read me before read above
- SCP-157-KO - No time to go to the toilet
- SCP-159-KO - Peach Blossom Land
- SCP-168-KO - Stir-fry?
- SCP-169-KO - The Volition Wins The Day
- SCP-171-KO - Forgotten Music
- SCP-185-KO - Visual Novel
- SCP-188-KO - Heart of the Earth
- SCP-189-KO - Dark alleyway
- SCP-212-KO - Rusty Spade
- SCP-217-KO - USS Enterprise
- SCP-222-KO - A Train in Flames
- SCP-229-KO - Quadrennial
- SCP-234-KO - Doing Dootie Duty
- SCP-268-KO - STRUCTURE ERROR
- SCP-299-KO - A Murder of Crows
- SCP-310-KO - Foods From That Far Place
- SCP-321-KO - Fade-in Virus
- SCP-326-KO - Natural reality fixation
- SCP-345-KO - The Space Hero
- SCP-380-KO - Now the test begins.
- SCP-412-KO - [DATA NOT EXPUNGED]
- SCP-416-KO - There is an instrument buried under the oak tree.
- SCP-432-KO - The Child Gifted With Immortality
- SCP-444-KO - Avici
- SCP-499-KO - The real "BGM"
- SCP-500-KO - The only cure
- SCP-503-KO - Normalcy Classification System
- SCP-505-KO - The Schoolbag
- SCP-521-KO - What is Seeing?
- SCP-545-KO - The Non-Flying Dutchman
- SCP-602-KO - I want to be myself for once
- SCP-621-KO - I will live in ██
- SCP-650-KO - The Duty to Stop All Sin and Unhappiness On This World
- SCP-689-KO - Fangi
- SCP-702-KO - Grownups Don't Know
- SCP-709-KO - Dismembered Eternity
- SCP-713-KO - Gods of the Flying House
- SCP-750-KO - Revenant Soldier
- SCP-755-KO - Learn all the technology and knowledge you want; there are Other Important Things
- SCP-774-KO - Planet Indra
- SCP-797-KO - Skyfall
- SCP-809-KO - Along the thorny vines
- SCP-817-KO - Flame of Love
- SCP-819-KO - Open the Curtains, Lights on
- SCP-824-KO - 22×6×1023 drops of water
- SCP-825-KO - Sokcho Tongkeun Mulhoe Restaurant
- SCP-826-KO - Homo Sapiens
- SCP-827-KO - It's Beginning to Smell a Lot Like Christmas Everywhere I Go
- SCP-828-KO - A Door Locked from the Inside
- SCP-829-KO - MAD man
- SCP-830-KO - 's slippers
- SCP-841-KO - Supervisor: Antimeme Expert Lee Hanseok
- SCP-876-KO - Head Siren
- SCP-877-KO - B████d B████s
- SCP-890-KO - Here be We, the Consequence of Your Actions
- SCP-897-KO - [ASMR] Dentistry / Teeth Extraction Relaxing Sound
- SCP-903-KO - Not Steroids!
- SCP-916-KO - Perfectly Replaces the Biological Patriarch
- SCP-923-KO - The Anti-Disney Department
- SCP-953-KO - Pretending Humanoid
- SCP-973-KO - Man With Gun
- SCP-980-KO - Cloudy with a Chance of People
- SCP-997-KO - The Edge of Esotery
- SCP-516-KO-EX - [DATA REDUCED]
- SCP-7891-KO-EX - Amnestic Mushroom
- SCP-001-EX-KO-J - A Bad Boy
- SCP-1004-KO-J - Girls' Magic Wand
- SCP-none-KO-J - It's an annoying clothes hanger!
Китайский филиал
- CODE NAME: Darkequation - Bamboo Scroll
- CODE NAME: Anglia - Dragon Vein
- CODE NAME: Veleafer - 演绎部
- CODE NAME: Re_spectators - Substitution Reaction
- SCP-CN-009 - Question, Solve, Answer
- SCP-CN-010 - Aye-aye
- SCP-CN-026 - No Longer be Alone
- SCP-CN-048 - A Failed Attempt
- SCP-CN-066 - OMG! What the Foundation Has Failed to Do for 20 Years Was Done by SCP-CN-066 in Just 4 Seconds…
- SCP-CN-096 - "Stop" "Door"
- SCP-CN-111 - The Solitary Venerable One
- SCP-CN-114 - Pine of Awakening Smoke
- SCP-CN-121 - The Badge of Dr. Sun Yat-sen
- SCP-CN-, 00122 - Fifthist Memetics
- SCP-CN-145 - Hometown
- SCP-CN-161 - Interpreter
- SCP-CN-166 - Embryos
- SCP-CN-171 - Dormitory Manager
- SCP-CN-176 - Uncle Sweets
- SCP-CN-180 - SPEEDCORE GENERATOR!!!
- SCP-CN-204 - Thunder Trial
- SCP-CN-233 - Dot Matrix
- 丂匚卩 句丹丂卄 匚几 句丹丂卄 丅山口 几丨几乇 丂丨乂 - 卄丹几乙丨 从乇从乇
- SCP-CN-312 - What Does She Know?
- SCP-CN-326 -
In Fading BooksA Digital Music Fantasy Is Reborn - SCP-CN-366 - Exist
- SCP-CN-369 - Self-Declaration Rostrum
- SCP-CN-404- Memetic Immunity Disease
- SCP-CN-412- Beauty Camera
- SCP-CN-440- Immortals of the Table
- SCP-CN-444 - Heavenly Sounds
- SCP-CN-445 - A Failed Anomalous Document
- SCP-CN-475 - Entombing
- SCP-CN-514 - Insomnia
- SCP-CN-529 - No Longer Human
- SCP-CN-534 - Mr. Dialect
- SCP-CN-546 - Our Secrets
- SCP-CN-661 - Dick, St. Dick
- SCP-CN-666 - Hold the Bottom Line
- SCP-CN-673 - A bunch of statues what move when you dun look at dem
- SCP-CN-675 - The Great Kyet Khaewt Device
- SCP-CN-678 - Stranger
- SCP-CN-713 - Keyboard Fish
- SCP-CN-717 - Throat Forest
- SCP-CN-731 - Black Sunset
- SCP-CN-756 - Book of Numbers
- SCP-CN-757 - Tiny World
- SCP-CN-758 - Mini-Foundation
- SCP-CN-767 - Chart Syndrome
- SCP-CN-797 - The Wandering Train
- SCP-CN-805 - Magic: The Gathering
- SCP-CN-810 - "Gold Foil"
- SCP-CN-829 - Spherical Potatoes
- SCP-CN-844 - The Seed of Lovesickness
- SCP-CN-861 - The pedestrian in a painting
- SCP-CN-879 - Programmable Office Building
- SCP-CN-918 -
Ever-DriftingPaper Plane - SCP-CN-937-J - A Useful Toilet
- SCP-CN-964 - I'll turn on the Bluetooth and listen to some tunes
- SCP-CN-985 - Exam Shark
- SCP-CN-999 - Spreading Your Wings
- SCP-CN-1000 - 2300
- SCP-CN-1001 - Writing Ends Here
- SCP-CN-1050 - "Aquarius"
- SCP-CN-1076 - "Have another bottle"
- SCP-CN-1080 - A Silent Bell
- SCP-CN-1099 -
Tin of Sardines - SCP-CN-1123 - CTTGGGAGATGAATAGATGGGTTGCAACCCATCTATT……
- SCP-CN-1138 - Anime Must Be Destroyed
- SCP-CN-1145 - A Nonexistent Elevator
- SCP-CN-1174 - Royal Quiet Deluxe Typewriter
- SCP-CN-1256 - SCP Foundation Chinese Branch Chronicle
- SCP-CN-1260 - Origin of Species, or Machinery of Creation
- SCP-CN-1276 - "Zekkōchō Conveyor Belt Sushi Restaurant!"
- SCP-CN-1391 - hamster pill by dado
- SCP-CN-1409 - 4200006200
- Work Notes: SCP-CN-1417
- SCP-CN-1424 - not spicy mouthwash by dado
- SCP-CN-1463 - Catgirl Training Plan
- SCP-CN-1483 - Those distant, cold stones
- SCP-CN-1500 - pʰoʃma
- SCP-CN-1537 - Storytelling
- SCP-CN-1604 - A Gun That Gets More Powerful As It Kills More People
- SCP-CN-1621 - become cat pill by dado
- SCP-CN-1666 - Veilbreak
- SCP-CN-1691 - A machine looking for loved ones
- SCP-CN-1733 - The Empty Patches of Sky
- SCP-CN-1767 - What is Papa's Mama Called?
- SCP-CN-1780 - Red Light, Green Light
- SCP-CN-1831 - Human-repelling Incense
- SCP-CN-1835 - The day the music died. Except for you.
- SCP-CN-1837 - USB Sword
- SCP-CN-1920 - J-Q-X, three brothers, see fish eyes and dig them out
- SCP-CN-1976 - Little Red Book
- SCP-CN-1987 - Plunger
- SCP-CN-1997 - When Magic and Science Intersect
- SCP-CN-2019 - Forbidden Borderline Θ
- SCP-CN-2035 - Terminal Entertainment!
- Riddle-2109: God
- SCP-CN-2176 - Zero-Calorie Biscuits
- SCP-CN-2200 - Hyper Dimension Action
- SCP-CN-2215 - A Literary Opinion
- SCP-CN-2227 - Drunk Alone
- SCP-CN-2270 - Rainbow Mount
- SCP-CN-2300 - 1000
- SCP-CN-2304 - The Sun is Tired of Rising
- SCP-CN-2345 - Memory-Carrying Enoki
- Observation File #CN-2380 - When Spring Comes
- SCP-CN-2399 - Still Raining
- SCP-CN-2401 - Sick Hall
- SCP-CN-2402 - The Star Nearby
- SCP-CN-2403 - Dodgeball
- SCP-CN-2405 - Ronald McDonald
- SCP-CN-2406 - … would much rather have KFC!
- SCP-CN-2426 - McNugget Fundamentalism
- SCP-CN-2440 - A video of torturing tubers
- SCP-CN-2517 - A Man Who Can
not, In Fact, Fly - SCP-CN-2620 - Birthday
- SCP-CN-2626 - D4C
- SCP-CN-2631 - Aliens Speaking English
- SCP-CN-2636 - MTF-己申-20 ("We")
- SCP-CN-2740 -
Addictive Minecraft, Sentient NPCs, Digital Lies, Longing for Reality - SCP-CN-2752 - I See the Machine Core Before the Mechanical Revolution
- SCP-CN-2781 - Before Sleeping
- SCP-CN-2806 - Slickness
- SCP-CN-2835 - Where am I?
- SCP-CN-2878 - Very Annoying Mosquitoes
- SCP-CN-2879 - Very Big Strainer
- SCP-CN-2880 - Very Sharp Sword
- SCP-CN-2918 - The Pleasant Sound of Rain
- SCP-CN-2926 - Big Prime Number
- SCP-CN-2980 - Your Copper Sulfate Friend
- SCP-CN-2987 - Don't Look Up
- SCP-CN-2989 - DEMONSTRATION OF THE PRECENCE
- SCP-CN-2991 - Why disbelieve ye in the revelations of Anormaly, when ye bear witness
- SCP-CN-116-EX - A Dazzling, Lively Relic
- SCP-CN-3300-EX - The Lamb has Died
- SCP-CN-123-J - How Many Urinals Do We Need?
- SCP-CN-213-J - The Magical Geoduck
- SCP-CN-404½-J - "The Foundation is FAKE!"
- SCP-CN-421-J - The Great Radish
- SCP-CN-555-J - Hurts Like Hell!
- SCP-CN-666-J - Mew Mew Mew
- SCP-CN-963-J - Extremely Annoying Codes
- SCP-CN-1616-J - WTF YOU SAID YOU DIDNT REVIEW
- SCP-CN-2000-J - Foundation's Bizarre Black-Technologies
- SCP-CN-2719-J - "Waifu"
Французский филиал
- CODE NAME: Dr. Gray - Not all angels have wings
- CODE NAME: Dr. Johannes - Program Xibalba
- SCP-014-FR - Agent of Chaos
- SCP-021-FR - Lights of the Cliffs
- SCP-027-FR - "Get Rick Rolled"
- SCP-031-FR - The Knowledge-Eaters
- SCP-043-FR - Blind Wanderer
- SCP-045-FR - Thieving Arthropod
- SCP-059-FR - Blizzard's Claws
- SCP-060-FR - The Lich
- SCP-061-FR - The Kiwi
- SCP-073-FR - Biological Sterilizer
- SCP-089-FR - The Athena Project
- SCP-095-FR - The Demon Core
- SCP-113-FR -
Infected fileS.O.S. - Dr. Anton Vehan - SCP-116-FR - Trabant 601 S "Hermes"
- SCP-125-FR - Mark IV
- SCP-137-FR - The One True Religion
- SCP-143-FR - Mesozoic chicken coop
- SCP-150-FR - Vox
- SCP-155-FR - Wake up
- SCP-161-FR - The Book And The Beast
- SCP-164-FR - Creationism
- SCP-172-FR - "Points of View"
- SCP-181-FR - Non-recyclable
- SCP-185-FR - Kinetic Inverter
- SCP-192-FR - Your question
- SCP-197-FR - Gardener Tortoises
- SCP-198-FR - Considerations on the Causes of the Greatness of Mankind and its Decline
- SCP-201-FR - Mind Palace Syndrome
- SCP-213-FR - The Vagabonds of the Dark Forest
- SCP-215-FR - Industrial Sardine
- SCP-218-FR - The Antiquity Manufacturer
- SCP-227-FR - Horoscomaton®
- SCP-233-FR - The Pillow That Makes You Sleep
- SCP-237-FR - Absurd Instability
- SCP-281-FR - The Day The Earth Stopped Being Flat
- SCP-291-FR - Containment Procedures Updated
- SCP-296-FR - Dusk on Mars
- SCP-299-FR - 113-B
- SCP-320-FR - Life is a pillow
- SCP-324-FR - He Died Thrice
- SCP-327-FR - Foresight Cameras
- SCP-335-FR - Lacrymodjinn
- SCP-347-FR - Risky Driving
- SCP-361-FR - Matriarch
- SCP-375-FR - Proof of the existence and uniqueness of the Self
- SCP-400-FR - She's Too Beautiful to be True
- SCP-403-FR - Güiro in Exile
- SCP-418-FR - Maurice the Concept-Eating sheep
- SCP-445-FR - Monkey See, Monkey Shoot
- SCP-466-FR - The Cottage Pottage
- SCP-471-FR - Riders on the Storm
- SCP-476-FR - Molecular Voodoo Dolls
- SCP-484-FR - Billy the Euc-kid
- SCP-503-FR - An Imperfect Allegory
- SCP-505-FR - Before Aleph
- SCP-510-FR - 5 Stars
- SCP-540-FR - The Grass is greener
- SCP-555-FR - The SCP Religion
- SCP-569-FR - Dimensional gloryhole
- SCP-589-FR - The Lamppost Song
- SCP-192-FR-J - Chicken that runs like really really fast
- FCP-676-FR-Vay - Exftremely Danverouf Viruf
- SCP-1054-FR-J - Schisms
- SCP-SKIP-FR-J - Skip For Long Optimal Multifunction Whiteness ©
Польский филиал
- CODE NAME: ZeroStrider — Wingless Birds
- SCP-PL-007 - Happily nonexistent object
- SCP-PL-023 - Written World
- SCP-PL-030 - The Mulch
- SCP-PL-037 - The Haunter
- SCP-PL-052 - Subtemporal bracer
- SCP-PL-057 - Leccinum Disappearing
- SCP-PL-066 - Trapdoor in a storeroom
- SCP-PL-067 - Dog that traveled in time
- SCP-PL-078 - Earrings of Instant Meetup
- SCP-PL-086 - I know about the Foundation
- SCP-PL-091 - Calcumuttons
- SCP-PL-144 - Analogue Virtual Reality
- SCP-PL-149 - The Cinema
- SCP-PL-150 -
On vacations
- SCP-PL-152 - Pet snakes
- SCP-PL-160 - Fat Burner
- SCP-PL-166 - Cemetery lights
- SCP-PL-173 - Fungal sounds
- SCP-PL-174 - R'EALITYBLENDER™
- SCP-PL-180 - Those who embark with us
- SCP-PL-183 - Lust of Speed
- SCP-PL-186 - Art is Death
- SCP-PL-195 - Gift from a friend
- SCP-PL-200 - Responsible Reading
- SCP-PL-203 - Weather for 2033
- SCP-PL-204 - How to Disappear Completely and Never Be Found
- SCP-PL-213 - Gloria Necatis
- SCP-PL-231 - The Wrath of Perun
- SCP-PL-248 - Heraclitic Tears
- SCP-PL-253 - WHAT IN THE KENTUCKY FRIED FUCK
- SCP-PL-259 - The list of territories conquered by Genghis Khan is incomplete, you can help by expanding it
- SCP-PL-260 - We know where you live
- SCP-PL-262 - A
- SCP-PL-267 - Mieszko, Mieszko, mój koleżko
- SCP-PL-284 - Oh God, oh fuck
- SCP-PL-289 - A Multidimensional Solution For Shopping at Biedronka
- SCP-PL-290 - Empiricism
- SCP-PL-121-J - Diego the Turtle
- SCP-PL-2004-J - The very fast vehicle of anthropomorphic amphibian
- SCP-PL-2021-J - The hope for our world
- SCP-PL-6470-J - Cat meme [DANGEROUS]
Испанский филиал
- CODE NAME: Uncle Nicolini - The Nexus of Babel
- SCP-ES-038 - The Bussinesman
- SCP-ES-039 - Satellipeople
- SCP-ES-040 -
Polaris Leporidae
- SCP-ES-044 - Necrofauna Arthropoda
- SCP-ES-048 - The Power of Ideas
- SCP-ES-054 - The Garden Gnome Gardeners
- SCP-ES-058 - Stilhed Overalt; Silence Everywhere
- SCP-ES-059 - Thirteen Little Fingers
- SCP-ES-069 - The Twine upon the Fate of her Appeal to Look
- SCP-ES-070 - Narcissus and the Plain of the Arrows of Eros
- SCP-ES-076 - https://www.youtube.com/watch?v=fgm14D1jHUw
- SCP-ES-081 - Gluttony
- SCP-ES-083 - deCipher'em All v1.6
- SCP-ES-087 - Sandbox; Intentional Continental Drift; I don't know biology so I'll turn fish into birds.
- SCP-ES-089 - The Last Emperor of Hoiohiña
- SCP-ES-090 -
Nine Lights Emissary
- SCP-ES-091 - Eugenics Nightmare
- SCP-ES-095 - A Victimless Crime
- SCP-ES-096 - THE GALLEON, or; Hunt the Dutchman! Or; The Assfuckedship
- SCP-ES-097 - Fungi Reactor
- SCP-ES-098 - Kynodontos
- SCP-ES-099 - The Piano Concert
- SCP-ES-100 - For Your Safety, Please Use the Stairs
- SCP-ES-101 - Ye Shall Not Worship False Gods
- SCP-ES-102 - The Cage
- SCP-ES-103 - Frustrated Musician
- SCP-ES-105 - Stargazing The Other Stars
- SCP-ES-107 - Partnercaller3000
- SCP-ES-111 - An explorer fallen from somewhere else
- SCP-ES-112 - 🤑🔫 pay 2 win 🔫🤑
- SCP-ES-113 - Special Deal
- SCP-ES-115 - This is the Metro of Franco's Spain
- SCP-ES-116 - A Gossiper Gramophone
- SCP-ES-117 - A second chance
- SCP-ES-119 - The Ministry of Abnormalities of Cuba
- SCP-ES-120 - This Sickness Will Not Defeat Me
- SCP-ES-122 - greatGreenishGreenery v1.01
- SCP-ES-123 - Aurus Trading Company
- SCP-ES-125 - North Korean Orbital Bombardment System
- SCP-ES-132 - The Wall; The Selective; The Thing That Kills You; We Don't Let Fools In; The Witch Burning; The Booby Trap; Stress; These Fools Don't Learn; We Have The Key; The Key; I Need Sleep; Sometimes, A Break; Sometimes, A Life; Merlín
- SCP-ES-133 - The Green One always finds its way
- SCP-ES-136 - Penitent Cry
- SCP-ES-137 - Sadness
- SCP-ES-142 - The Bones of the Saints
- SCP-ES-143 - May the Light of St. George lead us to Victory
- SCP-ES-145 - Funerary Licentiousness
- SCP-ES-146 - Who am I?
- SCP-ES-147 - Cessation of Legacy
- SCP-ES-152 - The Fall of the Fools
- SCP-ES-157 - Coppélia
- SCP-ES-158 - And the Potatoes Took Over the Earth
- SCP-ES-163 - Elephant Graveyards
- SCP-ES-165 - Kaiju Sarcophagus
- SCP-ES-169 - The Hentai Dream Made True
- SCP-ES-173 - The last sacrifice to Vulcan
- SCP-ES-178 - The best re-union you will never have.
- SCP-ES-180 - It's not yours, it's ours
- SCP-ES-181 - The King Who Burnt
- SCP-ES-184 - Vitrified Fortresses
- SCP-ES-185 - Space Swallow
- SCP-ES-186 - Absolute Corruption of Power
- SCP-ES-191 -
Stellar Garden
- SCP-ES-193 - On the 13th of April, 2013, a Train Fell From the Sky
- SCP-ES-194 - That motherfucker Fidel Castro just won't stay dead!
- SCP-ES-196 - Buried Dreamers
- SCP-ES-199 - Institution for Dealing with Your Issues of Normalcy
- SCP-ES-200 - Mind Control Ball Cactus
- SCP-ES-201 - Theatrum Mundi
- SCP-ES-202 - What is HANSARP?
- SCP-ES-203 - Super Golden Fruit
- SCP-ES-208 - Flying Pigs
- SCP-ES-216 - Lutiya, Pillar of Silence
- SCP-ES-220 - Burning Soul
- SCP-ES-230 - EAGLE Protocol
- SCP-ES-232 - Gramophone Gal (Do You Like Gramophones?)
- SCP-ES-234 - Detective Marw, Private Eye
- SCP-ES-245 - Autarchy of Atonement
- SCP-ES-250 - First Parca: Sons of the Harvest
- SCP-ES-251 - Second Parca: Tales of Misery
- SCP-ES-252 - Third Grim Reaper: The Life of Death
- SCP-ES-256 - At midnight
- SCP-ES-260 - The Blue Eyes of Gea
- SCP-ES-261 - The taste of the stars and the desolation of Juno
- SCP-ES-262 - RAVEYARD
- SCP-ES-264 - A Friendly Crab
- SCP-ES-266 - Scavenger Jellyfish
- SCP-ES-268 - Electromagnet-shrooms
- SCP-ES-284 - A, last? regret
- SCP-ES-288 - Who is that walking beside you?
- SCP-ES-290 - Wrong Taxi
- SCP-ES-296 - The Path From Which We Come From
- SCP-ES-297 - 🌮🔔
- SCP-ES-100-EX - Mother Nature
- SCP-ES-112 Extended Testing Log
- Document-ES-061-B
- SCP-RU-178 - The Heroes Of Vólorovsk
- Proposal by Nico, Who Has Gone A Little Crazy
- SCP-ES-I don't care-J - I don't care
- SCP-ES-050-h2o-J - Bears are better than crocodiles. Probably.
- SCP-ES-101-J - The Hard-To-Open Container
- Emily Miranda Sends Nudes
Тайский филиал
- CODE NAME: DrSSS - Another World Comers
- SCP-009-TH - Human Anatomy Model
- SCP-043-TH - Human Ice Cream
- SCP-072-TH - The Castle Guards
- SCP-400-TH - The Elephant is a Blood-thirsty Animal
- SCP-412-TH - The Lattice (The Hydrologic Cycle)
- SCP-747-TH - The Black Box
- SCP-901-TH - The Giant Head
- SCP-903-TH - Very Huge Dinosaur
- SCP-025-TH-J - Stop for Inspection Sign
- SCP-222-TH-J -
The Troll CatThe Genius Hacker Cat
Японский филиал
- CODE NAME: solvex - Acquittal and Miniascape
- CODE NAME: amamiel - Ave Maria
- CODE NAME: indonootoko - Arahitogami
- CODE NAME: k-cal -
The Balance ScalesThe Handover Report You Want - SCP-010-JP - "Mirai PC"
- SCP-017-JP - Local Rules
- SCP-020-JP - Winged Human
- SCP-023-JP - Shadow Railway Line
- SCP-030-JP - Petroleum Devourers
- SCP-043-JP - Seasoning that Makes Anything Edible
- SCP-047-JP - "For the Greatest Music"
- SCP-065-JP -
from today on i am the prime ministerAll We Need Is Dominator - SCP-076-JP - Terror Overhead
- SCP-082-JP - To the Desired Country
- SCP-086-JP - Zombie Virus
- SCP-088-JP - Babies Can Choose Their Moms and Dads to Be Born to
- SCP-094-JP - Marine Man
- SCP-095-JP - Satō Saitō
- What is SCP-105-JP? I've investigated it in my own way!
- SCP-115-JP - Nue
- SCP-120-JP - The World's Most Valuable Jewel
- SCP-132-JP - One Fish, Two Fish, Paper Fish, Silverfish
- SCP-167-JP - Restaurant Seashore
- SCP-181-JP - Effective Advertising
- SCP-184-JP - Worn-Out Utility Pole
- SCP-194-JP - Paradise Inside a Memory
- SCP-199-JP - Another Audience
- SCP-266-JP - A Town Without Anyone
- SCP-268-JP - The Never-Ending Epic
- SCP-272-JP - "Floora"
- SCP-277-JP - Feigning Death Tank
- SCP-333-JP - The Earthlings
- SCP-359-JP - Penguin Mushroom
- SCP-373-JP - Manufacturing Group
- SCP-398-JP - Eternal Room 105
- SCP-407-JP - A Tub
- SCP-419-JP - An Alternate History of Easter Island
- SCP-444-JP - █████[ACCESS UNAUTHORIZED]
- SCP-475-JP - I Want to See Only Beautiful Things
- SCP-496-JP - Warning: Electronic Protocol in force when viewing this document
- SCP-522-JP - Airborne Baguette Concentration Measurement Station
- SCP-534-JP - Get a Glass for Flea
- SCP-546-JP - Sugar and Spice and All That's Nice
- SCP-548-JP - Singing Rain Sounds
- SCP-557-JP - Déjà Mort
- SCP-558-JP - Bunch o' Chicks 'n' BIG MAMA
- SCP-569-JP - Konpeight
- SCP-571-JP - NIGIRI OF THE DEAD
- SCP-583-JP - Darkness of the Remembrance
- SCP-586-JP - Snow Globes Past the Sell-By Date
- SCP-588-JP - Transdimensional Buttock Wall ~ A Karcist's Ass Sticking Out Into Our Universe ~
- SCP-632-JP - Human Internal Ants
- SCP-646-JP - A Retro-bender
- SCP-654-JP - Matryoshka
- SCP-656-JP - Human Repellant Plastic Bottles
- SCP-671-JP - The Night of Electric Jellyfishes
- SCP-682-JP - Tough Microbe
- SCP-737-JP - Merciful Jewelry Workshop
- SCP-747-JP - How To Boil Some Eggs In This Shifting Universe
- SCP-751-JP - EVERYBODY,FUCK YOU
- SCP-787-JP - How Those Vacuous Spines Got So Close To You
- SCP-818-JP - How great-
- SCP-828-JP - Launching Site
- SCP-830-JP - Downfall of One Night Castle
- SCP-831-JP - Lurking Summer
- SCP-835-JP -
XenophobiaKeteru Yamiko - SCP-838-JP - Urban Waves
- SCP-903-JP - Mr. Kojirō feat. Joyful Dancers
- SCP-905-JP - Freddie’s Special Flight Show
- SCP-918-JP - That's Someone else's Lost Dreams
- SCP-922-JP - Animal Relocation
- SCP-926-JP - Oneiric Eternal Recurrence Of The Nightmare Beast
- SCP-949-JP - Overrunning Bulldozer
- SCP-981-JP - Wenkankanhoyaukamuy
- SCP-1012-JP - Inversive Monotony
- SCP-1020-JP - Feeding Bowl for Chucky
- SCP-1044-JP - For Those Who Will Listen
- SCP-1045-JP - Corrective Lenses
- SCP-1078-JP - Less Guilt-Provoking Laboratory Organisms
- SCP-1100-JP - CAPTCHA
- SCP-1118-JP - Tokyo DisneySky
- SCP-1134-JP - Explosive Nigiri Sushiblade
- SCP-1139-JP - Electronic Diva
- SCP-1201-JP - Lakebed Electronics Store
- SCP-1242-JP - Abyssal Toilet Stall
- SCP-1249-JP - People
- SCP-1299-JP - They're All Alive
- SCP-1300-JP - An Offering to S
- SCP-1302-JP - Revolving.
- SCP-1304-JP - The Day the Wild Thistle Fell
- SCP-1305-JP - Infinite Monkey Would Never Abuse Drugs
- SCP-1330-JP - Crackti
- SCP-1332-JP - Mule at the Edge of the World
- SCP-1334-JP - Towards the Beach
- SCP-1357-JP - Kingfisher, Shining As Bright As Fire
- SCP-1379-JP - annoying omnipotent
- SCP-1405-JP - British White Silver Garden
- SCP-1407-JP - Chicks could remember
- SCP-1431-JP - I Really Wanna make them into Moss.min.js
- SCP-1440-JP - と
- SCP-1444-JP - Reenacting Proof for the Sake of Pleasure
- SCP-1475-JP - Target North Carolina!
- SCP-1494-JP - The Roadkill is Always Watching Over Us
- SCP-1495-JP - The Bystander is Only Watching for All Time
- SCP-1548-JP - You Offend My Eyes
- SCP-1566-JP - When the Body Dies, the Mind Also Dies; and When the Mind Dies, the Body Is As Good As Dead
- SCP-1576-JP - Hence the God Exists
- SCP-1577-JP - The Cow Lay Down On The Grass Because It Was So Starving
- SCP-1579-JP - A Man's Neighbor
- SCP-1581-JP - Graveyard is Full of Balloons
- SCP-1646-JP - Everything is in a Dream
- SCP-1657-JP - Eyedrops From the 2↑↑↑↑2nd Floor
- SCP-1673-JP - Moses and the Hot Springs
- SCP-1677-JP - Space Jumper
- SCP-1687-JP - With You, Someday/Eternally
- SCP-1690-JP - Tān, or Ouroboros
- SCP-1693-JP - Birth of the Prison
- SCP-1709-JP - Katana of Poetic Justice
- SCP-1710-JP - CHOPIN GODZILLA
- SCP-1721-JP - Love-Doll Retriever
- SCP-1732-JP - Toutei - Invitation
- SCP-1748-JP - Someday Somewhere
- SCP-1774-JP - Natural Apple
- SCP-1783-JP - The Ship is Full of Rabbits
- SCP-1792-JP - Guillotine Lemonade, Friendly Price 25¢
- SCP-1803-JP - Perpetual Generator, or a Black Box
- SCP-1810-JP - QR Bird
- SCP-1828-JP - Foggy Forest
- SCP-1841-JP - Don't Get Off Your Pedestal
- SCP-1857-JP - Cherry Blossom of Permanence
- SCP-1866-JP - A Job to Save the World
- SCP-1868-JP - Freed Headless Feline Carcasses (they can't go anywhere in the first place, and the neighbors don't give them a shit)
- SCP-1873-JP - Yoke of Flesh
- SCP-1876-JP - Out of Mom
- SCP-1934-JP - Shiba Inu on the Suspension Bridge
- SCP-1936-JP - This Connection Has Been Severed by a Nightmare Collective
- SCP-1944-JP - Unfortunate Flying Object
- SCP-1977-JP - Death Got A Non-Aquaphobic Horse
- SCP-1978-JP - Sailor Suit and Machine Gun
- SCP-1988-JP - Heisei Convenience Store Myths
- SCP-1995-JP - Ushi-Gozen
- SCP-1998-JP - A Girl Who Changes Shape with Extreme Force and a Super Deranged YouTuber
- SCP-2005-JP - Sword of Judgement, Bell of Forgiveness
- SCP-2048-JP - An Ordinary Coin
- SCP-2057-JP - Back to the Egg, Then It Hatches
- SCP-2061-JP - Adventure Tale at Gyouseiya Department Store
- SCP-2077-JP - Turing Shredder
- SCP-2113-JP - And He Closed His Eyes
- SCP-2152-JP - Tranquility, Anxiety, Drinking Down into the Darkness
- SCP-2170-JP - Oneigal Upload
- SCP-2188-JP - Light Fingers with a Ready Tongue
- SCP-2200-JP - BBC
- SCP-2203-JP - Reset
- SCP-2211-JP - Foundation Department of Hell
- SCP-2227-JP - Tell Me Stories
- SCP-2233-JP - He Who Was Mourned By As Many People As Possible
- SCP-2300-JP - Whether I Stay or Not, I May Never Go Anywhere
- SCP-2351-JP - Virtue's Vengeance
- SCP-2371-JP - Soytaurus
- SCP-2403-JP - Invasive Species Throwing Dude
- SCP-2422-JP - Language Kusōzu
- SCP-2424-JP - Lincoln Century
- SCP-2426-JP - Won't You Jump Out At Me From That Corner?
- SCP-2429-JP - Pufferfish Eten
- SCP-2433-JP - Wrongful Indulgence
- SLOT UNALLOCATED - That Which Kills Me
- SCP-2459-JP - It Must Be a Warm Place That Leads to Hell
- SCP-2472-JP - Nyankoderoga
- SCP-2476-JP - cat.exe (Modification Prohibited)
- SCP-2493-JP - Broken Smile
- SCP-2503-JP - Those Who Wait for Absolute Zero
- SCP-2505-JP - Processed Quail
- SCP-2507-JP - Jumpscaring Ghosts
- SCP-2513-JP - At Least, Be the Foundation
- SCP-2566-JP - RETURN PARADOX
- SCP-2580-JP - The Great Death
- SCP-2581-JP - Make Me Look Pretty☆
- SCP-2601-JP - "Me, and Yayoi, and Miyuki, and…"
- SCP-2613-JP - Fear Conditioner
- SCP-2626-JP (SCP-262-IE) - Casadh an tSúgáinTangled Thread
- SCP-2642-JP - Making "Project Arca"
- SCP-2650-JP - Transfeuneral
- SCP-2687-JP - Meaning of Life/Meaning of Death
- SCP-2707-JP - Floral Tribute for Me
- SCP-2733-JP - The Road To Hell Is Paved All Over With Good Intentions, Even Having Information Signs
- SCP-2744-JP - てるてるネコちゃん
- SCP-2755-JP - A Star at the Bottom of a Lake
- SCP-2760-JP - Dazzling with gold
- SCP-2784-JP - Someone is Talking About You Somewhere
- SCP-2788-JP - Your nth Dead Grandma
- SCP-2790-JP - Foundation Department of Retention
- SCP-2833-JP - SKYWELLS: THE SECOND
- SCP-2840-JP - The Room
- SCP-2844-JP - Cognitive Dissonance
- SCP-2851-JP - No Longer Red Needed
- SCP-2855-JP - SKYWELLS: THE FIRST
- SCP-2856-JP - My Hero
- SCP-2880-JP (Unassigned Number)
- SCP-2891-JP - Interstellar Retribution
- SCP-2904-JP - How Many Pigs Have You Ever Murdered?
- SCP-2920-JP - Strangulation Demon
- SCP-2955-JP - Septette for the Dead CN-Aniki
- SCP-2973-JP - The Man with the Most Powerful Abilities Ever
- SCP-2975-JP - "Cuz When I'm Up Late, I Wanna Eat Somethin'"
- SCP-2989-JP - The Star of My Wish Rises in the Clear Blue Sky
- SCP-666-JP-J - The Ultimate Horrible Object
- SCP-999-JP-J - The Tickle Master
- SCP-Shrimp-JP-J - > A saury <
- SCP-K2-JP-J - Oh shit !!!
- 5Ç卩-譁?ュ怜喧縺-JP-J - Untellable
- SCP-014-JP-EX - I Just Wanted to See that Look on your Face
Немецкий филиал
- SCP-009-DE - Cheap Gas
- SCP-015-DE - Dr. Duck
- SCP-017-DE - R.T.I. Grizzly A1
- SCP-028-DE - Sonderkommando for the paranormal
- SCP-030-DE - R.T.I. Hammer P1
- SCP-031-DE - Isabelle
- SCP-034-DE - Shower of dread
- SCP-042-DE - Avoid Containment
- SCP-045-DE - What are you searching for?
- SCP-046-DE - Shuffling Corpse
- SCP-051-DE - Mr. Soother
- SCP-056-DE - R.T.I Sentinel
- SCP-058-DE - Peaceful Zombies
- SCP-066-DE - The little Spellbook
- SCP-070-DE - Pink Colony
- SCP-076-DE - Face-Swap App
- SCP-083-DE - Badge of Physical Fitness
- SCP-087-DE - Confused AI
- SCP-089-DE - The Athena Project
- SCP-090-DE - I‘m SCP!
- SCP-091-DE - The Loving Doll
- SCP-096-DE - A Cosmic Phenomenon
- SCP-098-DE - Demon vs Machine
- SCP-099-DE - Gasmen
- SCP-100-DE - The gargoyle's misdeeds
- SCP-101-DE - Eik, the Tree of Knowledge
- SCP-117-DE - The News of the Day to Come
- SCP-121-DE - Telepathic humanoid
- SCP-122-DE - Frau Harlekina
- SCP-124-DE - Don't notice me
- SCP-125-DE - The Imprisoned Regent
- SCP-131-DE - Real Estate Shark
- SCP-136-DE - The boy who stops time.
- SCP-137-DE - Ice Phoenix
- SCP-140-DE - Morts volantes
- SCP-148-DE - Blue Slime [Level 25]
- SCP-149-DE - The Spirit of Ruin
- SCP-150-DE - Die Verteidiger
- SCP-173-DE - Hating Stones
- SCP-177-DE - The Rungholt Shard
- SCP-178-DE - Dreamlike Weather
- SCP-179-DE - To the most Righteous
- SCP-180-DE - A little cute Birthdaypenguin
- SCP-184-DE - Arachnophilia
- SCP-186-DE - The True Meaning of Christmas
- SCP-187-DE - Mathilda
- SCP-188-DE - B4 “Blitzgewitter”
- SCP-190-DE - Thor, God of Kebab
- SCP-192-DE - "Knowledge"
- SCP-200-DE - Higher Mathematics
- SCP-201-DE - Metal Dragon
- SCP-204-DE - The Chest of Eternity
- SCP-207-DE - The heart of Cupido
- SCP-208-DE - St Caesarius Hospital
- SCP-209-DE - The idiot box
- SCP-226-DE - Knight Cuddle Steel
- SCP-227-DE - Moo
- SCP-234-DE - A Christmas miracle
- SCP-236-DE - A cup of love
- SCP-237-DE - Her heart and his soul
- SCP-239-DE - USB Jird
- SCP-248-DE - Omni fork
- SCP-255-DE - The Perfect Mascot
- SCP-257-DE - A butt ugly owl
- SCP-260-DE - Ahead of her time
- SCP-272-DE - Megalodon
- SCP-281-DE - A pretty good hotel
- SCP-292-DE - Sweet Easter
- SCP-293-DE - Aliens, go home!
- SCP-296-DE - In death we blossom
- SCP-297-DE - Combustible Deep-Sleep
- SCP-299-DE - What the Future Holds
- SCP-004-DE-EX - Repulsive
- SCP-015-DE-J - This is why the SCP Foundation hates Ducks and Geese
- SCP-027-DE-J - The Big Bad Tap Hen
- SCP-033-DE-J - Earworm
- SCP-044-DE-J - This damn schnapps
- SCP-(INSERTANYNUMBERHERE)-DE-J - The Trainee
- The Things Dr Ore Is Not Allowed To Do At The German Branch Of The Foundation
Итальянский филиал
- CODENAME: /GRAF - The Dragon Of Revelation
- CODENAME: /ABAD - The Values Of The Fatherland
- SCP-002-IT - The Voice of the Piave
- SCP-010-IT - Parental Care
- SCP-011-IT - The Zero Zone
- SCP-012-IT - Waltz No. 2
- SCP-013-IT - Sentient Tornado
- SCP-015-IT - The Boogeyman
- SCP-017-IT - Sentient USB Pendrive
- SCP-018-IT - EMP Barn Owl
- SCP-019-IT - E-15 Chimera
- SCP-020-IT - Horse with Oratory Skills
- SCP-021-IT - The Capitoline Wolf
- SCP-022-IT - Legion
- SCP-023-IT - Hounds of the Dictator
- SCP-024-IT - Rebar ಉ
- SCP-025-IT - Kangaroo Mother
- SCP-029-IT - The Last Vestal
- SCP-032-IT - Haruspex
- SCP-035-IT - The Hammer
- SCP-037-IT - Subtle Vibration
- SCP-038-IT - Ocean Stones
- SCP-039-IT - Cordless Telephone
- SCP-041-IT - A Flat World
- SCP-042-IT - The Answer
- SCP-045-IT - The Hypogea of the Daunia
- SCP-050-IT - The Galleass
- SCP-054-IT - Microcosmos
- SCP-055-IT - The Devourers
- SCP-057-IT - Under the Sea
- SCP-066-IT - Diabolus ex Machina
- SCP-067-IT - The King of the Hill
- SCP-068-IT - Kaliperia
- SCP-070-IT - Forgotten Depths
- SCP-071-IT - Ötzi's cloak
- SCP-079-IT - Locus Amoenus
- SCP-080-IT - Shattered Civilization
- SCP-082-IT - The Helmet of Knowledge
- SCP-100-IT - Carnem Levare
- SCP-103-IT - Ciapapuer
- SCP-105-IT - Anachronistic Hallucinogenic Excrements
- SCP-149-IT - After the End of the Eternity
- SCP-004-IT-ARC - Infinite Tuning Guitar
- SCP-008-IT-ARC - The Hotel
- SCP-014-IT-ARC - XXXIII (Before Rewrite)
- SCP-001-IT-J - The “Dragon” Of Revelation
- SCP-002-IT-J - The Doctor-Destroyer
- SCP-610-IT-J - The Perfect Projectile
- SCP-1900-IT-J - The Pirate Kingdom
- SCP-F2Y-IT-J - The [EXPLICIT]
- Italian Sites -J - The best Sites of the Italian Branch!
Украинский филиал
- SCP-012-UA - The Library
- SCP-035-UA - Tablet of Veles
- SCP-038-UA - Alike to black holes
- SCP-046-UA - Tasty flashbacks
- SCP-049-UA - Apparently… God?..
- SCP-054-UA - Pater noster Bandera
- SCP-056-UA - Pit on the road
- SCP-065-UA - Deliver Us From Evil
- SCP-069-UA - Cast-iron charcoal iron
- SCP-079-UA - No-Sides
- SCP-081-UA - Vanka-Vstanka
- SCP-095-UA - Crazy Bee
- SCP-2014-UA-EX - SCP-2014-RU
- SCP-692-UA-J - Connection cockup
Португальский филиал
- CODINAME: Project Bulwark - by slashannemoo & Vintner
- SCP-002-PT - Women's Magazine
- SCP-003-PT - Silent Droplets
- SCP-004-PT - The Soldier and the Bomb
- SCP-006-PT - Freefalling Nightmare
- SCP-008-PT - Man-Man
- SCP-010-PT - Peppers
- SCP-011-PT - Victoria stella
- SCP-013-PT - Crazy Cyborg's Samba
- SCP-014-PT - Improvised Appearances
- SCP-015-PT - Electromagnetic Cannon
- SCP-016-PT - The Holy Grail
- SCP-018-PT - Unrecorded Man
- SCP-019-PT - Porcelain Dish
- SCP-021-PT - Crystal Theatre
- SCP-022-PT - Lawyers = Fairies and Vice Versa
- SCP-023-PT - Xeno's Paradox
- SCP-024-PT - A Longtime Friend
- SCP-025-PT - Portable Desert
- SCP-026-PT - Sober Drunk
- —————— - This Shouldn't Exist
- SCP-030-PT - Cultural Heritage
- SCP-031-PT - Pocket Imp
- SCP-034-PT - Creator Magnifying Glass
- SCP-035-PT - The Pigeon
- SCP-038-PT - Floating Snake
- SCP-040-PT - Ostium Theater
- SCP-041-PT - A Weapon Among the Stars
- SCP-042-PT - The ████ Opener
- SCP-043-PT - The Player
- SCP-046-PT - Read a Book, Write a Book
- SCP-049-PT - <N0:.WH3RE>
- SCP-050-PT - The Sack Man
- SCP-055-PT - Adaptive Tactical Armour for Containment and Assault
- SCP-057-PT - The Abandoned Hospital
- SCP-065-PT - Hard-to-Kill Armadillo
- SCP-078-PT - The Fog
- SCP-079-PT - Schrödinger's Planet
- SCP-088-PT - This Machine Kills Commies
- SCP-089-PT - I Shall Deeply Love You
- SCP-094-PT - Apamachi Identity Camouflage Device.
- SCP-101-PT - Manor of Madness
- SCP-106-PT - Sonic Flashlight
- SCP-110-PT - A Very Convincing Story
- SCP-118-PT - That Which Shares
- SCP-119-PT - The Pompous Girl
- SCP-122-PT - Factor XX
- SCP-143-PT - Escape from the Rio-Niterói Bridge
- SCP-150-PT - P███ G████´s Progressive Location Pen
- SCP-166-PT - The Light of the Court
- SCP-170-PT - [31/12/2025]: thank you.
- SCP-172-PT - Mother-of-Gold
- SCP-177-PT - Time Travelling Lottery
- SCP-191-PT - Acre's UFO
- SCP-195-PT - Special Gift for Naughty Workers
- SCP-196-PT - Midas Gloves
- SCP-199-PT - Spread the Word
- SCP-033-PT-EX - Dream-Catcher
- SCP-019-PT-J - The Big Ban Hammer
- SCP-045-PT-J - Monsterwave
- SCP-075-PT-J - Good Morning!
- SCP-109-PT-J - The Foundation
- SCP-005-PT-ARC - The Reason Why Dendrophobia Exists
- SCP-012-PT-ARC - Socrates
Чешский филиал
- SCP-017-CS - Absolute Justice
- SCP-023-CS - Why can't he just leave me alone?
- SCP-042-CS - Northern Devil
- SCP-073-CS - The cousin of Winnie the Pooh
- SCP-082-CS - Captive of a frequency
- SCP-087-CS - Splendid Light
- SCP-148-CS - Unfinished Business
Традиционный Китайский филиал
- SCP-ZH-002 - Taiwanese Unicorn
- SCP-ZH-003 - Extreme Religion
- SCP-ZH-004 - Marslow’s Daughter
- SCP-ZH-005 - If you haven't re-shared this article with ten friends, then…
- SCP-ZH-006 - The real meaning of popcorn
- SCP-ZH-037 - Tears from Hawksbill Sea Turtle
- SCP-ZH-038 - The Faceless Model
- SCP-ZH-041 - Dreams
- SCP-ZH-048 - Sword & Sorcery and Tea & Magic Hands
- SCP-ZH-060 - The Deer Road Tunnel
- SCP-ZH-105 - The Unfilials
- SCP-ZH-132 - The 007 Game That Kills You
- SCP-ZH-178 - The Bird Mug
- SCP-ZH-200 - Let's Tag
- SCP-ZH-228 - Tsuipu, 1947
- SCP-ZH-236 - Last Year Syndrome (Senioritis)
- SCP-ZH-251 - Ruins In Third Floor
- SCP-ZH-261 - Cuban Sugar
- SCP-ZH-282 - The Gourmet
- SCP-ZH-310 - Anomalous Protein Domain
- SCP-ZH-446 - Became Bug
- SCP-ZH-526 - I’m Just a Toaster
- SCP-ZH-545 - I'm Not A Dinosaur
- SCP-ZH-617 - The Brave One From the West
- SCP-ZH-618 - Sun Pastry Lion
- SCP-ZH-736 - You Can't Go Any Further
- Mrs. Alicia
- SCP-ZH-860 - dado's Hair/Have-fortune Drug
- SCP-ZH-889 - Beyond This World
- SCP-ZH-973 - As Your Hatred
- SCP-ZH-2005-EX - Internet Celebrity
- SCP-ZH-9288-EX - You are completely aware that you will never meet the person sitting next to you listening to your story ever again.
- SCP-ZH-00l - SCP-ZH-001
- SCP-ZH-60053-J - HONK
Вьетнамский филиал
- SCP-002-VN - Funeral
- SCP-006-VN - The Night Stars
- SCP-012-VN - One Gains, What One Wishes
- SCP-013-VN - Poisonous Milk
- SCP-014-VN - Dream Crayons™
- SCP-018-VN - The Two-Wheeled Hatred
- SCP-024-VN - The Beginning of All
- SCP-033-VN - Rubber Duck
- SCP-036-VN - The Cube
- SCP-040-VN - Those Black Words
- SCP-096-VN - Where the Earth Meets the Tide
- SCP-099-VN - The Waifu Heaven
- SCP-100-VN-J - The True Omnipotent SCP
- SCP-6789-VN-J - A Kettle-Class Loudspeaker
Фрагмент списка для редактирования
Содержание
3000-3099
3100-3199
3200-3299
3300-3399
3400-3499
3500-3599
3600-3699
3700-3799
3800-3899
3900-3999
3000-3099
- SCP-3010 - Causal-Absent Paranoia
- SCP-3011 - Loose Lips Skink Ships
- SCP-3012 - Smoke the Reefer, Meet the Reaper
- SCP-3013 - An Expression of Mourning
- SCP-3014 - Lonely Hungry Daemon
- SCP-3015 - A Story Concerning Self-Doubt, Slight Disillusionment, and Frustration, As Told By the Lucky Member of a Group Whose Relatable Works Are Loved Internationally
- SCP-3016 - Perpetual Motion Run Amok
- SCP-3019 - The Soylent Nursery
- SCP-3024 - The Doxx Ghost
- SCP-3025 - Lucidity
- SCP-3028 - Take On Me
- SCP-3032 - Ballistic Trees
- SCP-3033 - A Human Weapon
- SCP-3037 - A Model City
- SCP-3038 - A White Door
- SCP-3039 - An Antiquated Guide
- SCP-3040 - Give Her A Hand
- SCP-3042 - Dog Is Love
- SCP-3044 - Evolution In A Bottle
- SCP-3046 - Model TH-223
- SCP-3047 - To Be Drowned by A Train
- SCP-3048 - Tantalus
- SCP-3050 - Ogden
- SCP-3051 - Interactive Time Loop
- SCP-3053 - Off the Rails
- SCP-3055 - Yes, And
- SCP-3058 - Concavity
- SCP-3059 - Infictious Self-Insert
- SCP-3060 - Sleep Paralysis
- SCP-3061 - Reluctant Fiend
- SCP-3062 - The Lone and Level Sands Stretch Far Away
- SCP-3064 - Hymn of Courage
- SCP-3065 - The Man Cave
- SCP-3066 - Absurdity
- SCP-3067 - Interdimensional Pirate Radio Station
- SCP-3068 - Halycon Light Beta
- SCP-3069 - To Force the Hand of God
- SCP-3070 - Highly Unusual Attempts at Solar Conquest
- SCP-3071 - To Deny Sense
- SCP-3072 - They're Trading Away Our Lives Out There
- SCP-3075 - A Day At The Beach Is All It Takes
- SCP-3076 - Avidity
- SCP-3077 - Sugar Golems
- SCP-3079 - 300 Tricks: Stage Magic Made Easy
- SCP-3080 - The Power of Love
- SCP-3082 - Neverland's Lost Boys and Girls
- SCP-3084 - Seven Strangers at a Feast
- SCP-3085 - Seasons Change
- SCP-3087 - The Owl-Car
- SCP-3088 - Law Of The Land
- SCP-3089 - That Old Time Religion
- SCP-3090 - This girl's gone bad on a game attack!
- SCP-3091 - Temporal Funnel Trap
- SCP-3092 - Gorilla Warfare
- SCP-3093 - The Color Vulvide
- SCP-3094 - Fall into the Gaap
- SCP-3095 - Bird is the Word
- SCP-3097 - A Game Of Fetch
- SCP-3098 - Triviality
3100-3199
- SCP-3100 - The Reliquary
- SCP-3101 - Contain Me Harder
- SCP-3102 - The Conflagration
- SCP-3103 - Vengeful Wings
- SCP-3104 - Cops Magnet
- SCP-3105 - Laxity
- SCP-3106 - A Flesh Removing Bog
- SCP-3107 - The Well Documented Marble
- SCP-3108 - The Nerfing Gun
- SCP-3109 - Indeterminate Source
- SCP-3110 - One Man's Trash…
- SCP-3112 - InDi-Mail
- SCP-3114 - Wouldn't it be Chilly?
- SCP-3115 - 99.7 Cognitohazard FM
- SCP-3116 - It's time to stop posting
- SCP-3119 - Lord of the Dance
- SCP-3120 - Help Desk
- SCP-3121 - Get Out of My Head
- SCP-3122 - You Have Reached Your Destination
- SCP-3123 - Insult To Injury
- SCP-3126 - The Immobile Muse
- SCP-3127 - Nineteen Year Old Jessica Lambert And A Female Pig Of Abnormal Size, Forever
- SCP-3129 - Mr. November
- SCP-3132 - Crackin' the Back Knack
- SCP-3134 - The Things Left Behind
- SCP-3135 - Star Trek: The Next Generation: The Journey Continues!
- SCP-3139 - America's Labyrinth
- SCP-3140 - Botanical Warfare
- SCP-3141 - Anomalous Theorem
- SCP-3142 - If you can dream it, you can do it (as long as your dream is of being broke)
- SCP-3144 - The Real World Is Faker Than Wrestling
- SCP-3145 - Self-Insert
- SCP-3146 - Money Match
- SCP-3147 - Tongue Twisted
- SCP-3148 - Tranquility
- SCP-3151 - Movie in a Bottle
- SCP-3152 - The Last Love Letter
- SCP-3153 - Bugging Me
- SCP-3155 - We Never Sleep
- SCP-3156 - Civilization Carrier Case
- SCP-3157 - The Second Castle
- SCP-3161 - The Plight of Poor Sir Gregor
- SCP-3162 - Social Life
- SCP-3163 - The Almanack
- SCP-3164 - Character Test
- SCP-3165 - Dog Teeth
- SCP-3167 - Character Assassin (Or: The Serial Killer)
- SCP-3169 - finna nut
- SCP-3172 - A Field Of Unfortunate Flowers
- SCP-3173 - Forest Prison
- SCP-3174 - Kleiner Freund
- SCP-3175 - A Wish Granted
- SCP-3176 - Estimated Time Of Arrival
- SCP-3178 - Through God, All Things Are Possible
- SCP-3180 - No Strangers to Love
- SCP-3181 - Lemme Get It Boneless
- SCP-3182 - The Grocery Store
- SCP-3184 - I'm sick of bugs getting stuck in my god damn bathroom light
- SCP-3185 - The Public Domain Protection Service
- SCP-3187 - Honu
- SCP-3188 - This Man Must Die
- SCP-3189 - For The Man Who Has Everything
- SCP-3191 - Consciousness Emulator
- SCP-3192 - When the Bell Tolls
- SCP-3193 - Christmas War
- SCP-3194 - Divine Presence
- SCP-3196 - The Adventures of Rex Dangerly
- SCP-3197 - A Trickster God for the Modern Age
- SCP-3198 - Miniature Task Force
3200-3299
- SCP-3202 - The Deeper End
- SCP-3203 - The Swiss Bank Account
- SCP-3204 - The Quantum Horse
- SCP-3205 - Adventure Tourist
- SCP-3206 - Who Wouldn't Want A Vomeronasal Organ?
- SCP-3207 - The Think-Tank
- SCP-3208 - YKHN
- SCP-3209 - Boredom Butterfly
- SCP-3210 - Alternative Facts
- SCP-3214 - Star Quality
- SCP-3215 - Delicious Anemone
- SCP-3217 - Mail "H" for "Hero".
- SCP-3218 - Animals in Boxes
- SCP-3219 - This Sour Earth
- SCP-3222 - A Very Real Pencil
- SCP-3223 - Ancient Egyptian Pet Whisperer
- SCP-3224 - Family Tree
- SCP-3225 - Dream for Ourselves Alone
- SCP-3226 - HEADBONES™!!
- SCP-3227 - Dart Frog Flora
- SCP-3228 - добрите стари дни
- SCP-3229 - A Blessed Sea
- SCP-3230 - Intergalactic Isolation
- SCP-3233 - Tenrec Goddess Reborn
- SCP-3234 - Pure Grey Static
- SCP-3235 - The Baba-disease
- SCP-3236 - All Those Fucking Ideas
- SCP-3239 - When Death Comes Calling
- SCP-3240 - The Bones Of What You Believe
- SCP-3241 - The SS Sommerfeld
- SCP-3242 - Operative Disease Mouse
- SCP-3243 - The Green Warden
- SCP-3244 - Mountain Dew: Code Red
- SCP-3245 - Mr. Playing Games Is Bad For Your Health
- SCP-3246 - A Nice Old Lady
- SCP-3247 - A Magic Mime and his Mighty Morphin' Method Acting Spider Kids
- SCP-3248 - Who Shot Sulley?
- SCP-3249 - Me, Us, Them, Them
- SCP-3250 - Jesus Fried Chicken
- SCP-3251 - The Coconut Crab Captain
- SCP-3252 - The Permian-Triassic Extinction Event
- SCP-3253 - A Prison of Ink and Flesh
- SCP-3255 - A Light Shining Through The Holes Inside Your Eyelids
- SCP-3256 - Web of Murder
- SCP-3257 - A Priest in a Suitcase at Timbuktu
- SCP-3258 - God Killers
- SCP-3259 - Verminous Ark
- SCP-3261 - The Dragon's Tongue
- SCP-3262 - Fire of Unknown Origin
- SCP-3263 - Mr. Headgeworth's School for the Magically Gifted
- SCP-3264 - Causeless Effect
- SCP-3265 - It's Good
- SCP-3266 - Time Loop in the Ardennes Forest
- SCP-3267 - Memories Bound in Paper
- SCP-3268 - Digital Predator
- SCP-3269 - Pop Culture
- SCP-3273 - Self-Performed Brain Editing Manual
- SCP-3274 - Nowhere Else To Run
- SCP-3275 - Excuse me, this is the wrong pizza.
- SCP-3276 - Young Successful Independent Self-Employed CEOs
- SCP-3277 - Speak Softly And Carry A Big Stick
- SCP-3279 - The Afterimage
- SCP-3281 - [REDACTED BY AARS538]
- SCP-3282 - The Worm of Your Dreams
- SCP-3283 - The biggest back yard in Boise
- SCP-3284 - Uncontainable
- SCP-3285 - creative comas
- SCP-3286 - Sea Legs
- SCP-3288 - The Aristocrats
- SCP-3289 - Smile
- SCP-3291 - Flowers of Solomon
- SCP-3292 - The Land Before Time, For All of Time
- SCP-3295 - Thank You For Smoking
- SCP-3296 - The Drifter
- SCP-3297 - Gramma Always Remembers.
3300-3399
- SCP-3305 - The Father, The Son, and The Holy Toast
- SCP-3307 - Cornucopi-ass
- SCP-3308 - Crooked Excavator
- SCP-3309 - Where We Go When We Fade, Fade Away
- SCP-3310 - The Old Man of the Lake
- SCP-3311 - All the Little Chairs
- SCP-3313 - Poor Richard
- SCP-3315 - p e r s e v e r a n c e
- SCP-3317 - Libre la Livres
- SCP-3320 - Ethical Relativity
- SCP-3321 - Edge of the Universe
- SCP-3322 - Sister Cities
- SCP-3323 - R35urr3c710n
- SCP-3324 - Getting kidney stones in the past is more useful than you'd think
- SCP-3326 - The Threads of Fate
- SCP-3327 - Soviet Bunker(s)
- SCP-3328 - Where Dead Men Grow
- SCP-3329 - A Sucker Born Every Minute
- SCP-3330 - Études for the Universe
- SCP-3331 - With Apologies To John Cena
- SCP-3334 - Literally a Billion Memes
- SCP-3335 - The Hole in My Head Where My Mind Used to Be
- SCP-3336 - God Bless You
- SCP-3337 - Death Of The Artist
- SCP-3339 - Randall the Clown's Wacky Broadway Theatre
- SCP-3341 - Arabian Nasnas a.k.a. Somali Hungruf
- SCP-3342 - The Blackfoot Potato Transplants
- SCP-3343 - Beelzebub
- SCP-3345 - Crime Novel
- SCP-3346 - Worry Hat
- SCP-3347 - They Grow Up So Fast
- SCP-3348 - Lost Dictionary
- SCP-3349 - Printing EKG
- SCP-3350 - Shape Up!
- SCP-3352 - Bethlehem Steel
- SCP-3353 - Secrets for Sweets
- SCP-3354 - Killmotor Hill
- SCP-3355 - St. Nick
- SCP-3356 - The Unity of the Prokaryote
- SCP-3357 - Practice Makes Perfect
- SCP-3358 -
Anomaly ApartmentsSite-316 - SCP-3359 - The Dry Guy
- SCP-3360 - Proletariart, by San Francisco Jones
- SCP-3362 - A Forced Self-Insert
- SCP-3363 - The Citizen Kane of Lightning-induced Reality TV
- SCP-3364 - Time Static
- SCP-3365 - Lunar Module 16 ‘Phoenix’
- SCP-3366 - Man in Hole
- SCP-3367 - Prayers from Children, Eternally Answered
- SCP-3368 - Bees on the Brain
- SCP-3369 - A Living Joke
- SCP-3370 - Dead Air
- SCP-3371 - Beautiful Inside My Head Forever
- SCP-3372 - A Betrayer's Retribution and Quite the Earful
- SCP-3373 - Our Whole Universe was in a Hot Dense State
- SCP-3374 - Aquaria Phenomena
- SCP-3375 - Traveling Garden Eels
- SCP-3376 - The Dreaming Stone
- SCP-3378 - Info Drones
- SCP-3379 - D-11424 and the Arctic Meat Hole of Infinite Wonders
- SCP-3380 - Science, Technology, Engineering, Divinity
- SCP-3381 - Dream Studios
- SCP-3385 - The Last Voyage of the Far Horizon.
- SCP-3386 - Night Owls
- SCP-3387 - A Small World After All
- SCP-3389 - The Lake That Burns You
- SCP-3390 - A French Tank
- SCP-3391 - An Artificial God
- SCP-3392 - Euclid's Blackboard
- SCP-3394 - Brain Scientist
- SCP-3396 - The Empyrean Parasite
- SCP-3397 - Fortes Fortuna Iuvat!
- SCP-3398 - Hilbert's Grand Elevator
3400-3499
- SCP-3401 - Anyone Fancy A Cup Of Jade? Or maybe some Earl, or Jasmine?
- SCP-3402 - Rural Exodus Event
- SCP-3403 - Summer Dogs
- SCP-3404 - Down With the Sickness
- SCP-3407 - ¢10 Per Ticket
- SCP-3409 - The Chocolate Factory
- SCP-3410 - "It's just fucking golf!"
- SCP-3412 - Life in a Peaceful New World
- SCP-3413 - Irwin Shrugged
- SCP-3414 - Beware of Toilet Snake
- SCP-3415 - Employee of The Month, Every Month
- SCP-3416 - The Great Anoati!
- SCP-3417 - The Preachers of Globular Cluster Terzan 2
- SCP-3418 - Devourer of Flames
- SCP-3419 - Humants
- SCP-3420 - Too Many Ghosts
- SCP-3421 - Cell Phone Trees
- SCP-3423 - Inspirational Window
- SCP-3424 - Esto No Es Un Limón.
- SCP-3425 - The Joy of Creation
- SCP-3427 - Anatomical Civilization
- SCP-3428 - Buried Hummingbirds
- SCP-3429 - Just The Way It Is Now
- SCP-3430 - Baby Don’t Hurt Me…
- SCP-3431 - Refuse Koala
- SCP-3433 - I am a Deeply Superficial Person
- SCP-3435 - Analysis-Defying Dinosaur Painting
- SCP-3436 - ABE
- SCP-3438 - Recursive Romance
- SCP-3439 - A Postcard
- SCP-3440 - The Marvellously Macabre Mechanical Marionette Matinee
- SCP-3442 - Innovative and Synergistic Customer-Directed Actualization
- SCP-3444 - She Took The Midnight Train Going Anywhere…
- SCP-3445 - Grave Insights
- SCP-3446 - The Waders
- SCP-3449 - The Things Left Unsaid
- SCP-3451 - The Shade Closet
- SCP-3452 - Durendal
- SCP-3453 - The Juice is Loose
- SCP-3457 - The Rite of Solomon
- SCP-3458 - Bad Sectors
- SCP-3459 - Phobia Plague
- SCP-3460 - I'm Going to Change Your Life
- SCP-3461 - When The Saints Go Marching In
- SCP-3462 - Lights, Camera, REDACTION
- SCP-3463 - Flawless Objective Perception
- SCP-3464 - Olive Garden regularly communes with DEMONIC ENTITIES to summon their SATANIC sempiternal garlic bread
- SCP-3465 - Better Safe Than Sorry
- SCP-3466 - Only Birdbrains Live the American Dream
- SCP-3467 - Anomoaly
- SCP-3468 - Only YOU can prevent forest fires
- SCP-3469 - Nice Cream
- SCP-3471 - Paint Under the Bridge
- SCP-3472 - Mother Loves her Baby
- SCP-3473 - The Son of the Sun
- SCP-3474 - Grief Ignited
- SCP-3475 - Our Shifting Foundations
- SCP-3476 - A Place to Sever Stranded Heartstrings // Alex's Fountain
- SCP-3478 - A human-shaped hole to the meat dimension
- SCP-3479 - Proof We Are All As Angels
- SCP-3480 - Olympus Mons
- SCP-3481 - Glorious Sounds
- SCP-3482 - fine mayor posters campaign by dado
- SCP-3485 - Omega Messier
- SCP-3486 - Baby Mine
- SCP-3488 - Mimir, The Root Of All Knowledge
- SCP-3493 - The Great SCP Foundation Collaboration
- SCP-3495 - St. Brendan's Howler Monkey
- SCP-3496 - Can We Bee Friends?
- SCP-3497 - Backfiring Birds
- SCP-3498 - Monachopsis
- SCP-3499 - Please Stand By
3500-3599
- SCP-3500 - Instructions Unclear, Got Dick Stuck in Canon 🍆➡️📕
- SCP-3501 - The Storyteller of Isfahan
- SCP-3503 - Panic is Pure, Trauma is True, Suffering is Sweet, and Death's a Delight
- SCP-3504 - "And how will we know you are one of us?"
- SCP-3506 - The Reading of the Will
- SCP-3507 - Father, This Day I Bring You True Glory
- SCP-3508 - "Cute and soft! Kill them off!"
- SCP-3509 - The Test Chamber
- SCP-3510 - Not Another New World Order!
- SCP-3511 - Reach Out And Touch
- SCP-3514 - The Moment of the Mahdi and the Moment of the Mortal
- SCP-3517 - A Hideous Mountain
- SCP-3518 - Arctic Shrimp
- SCP-3520 - Fourteen Orangutans
- SCP-3522 - Black Body
- SCP-3523 - The Quarry
- SCP-3524 - You Cannot Contain Us
- SCP-3525 - A 5-Star Lyft Driver
- SCP-3526 - Ave, True to Caesar
- SCP-3529 - snake = snek = cute ^~^
- SCP-3530 - Shooting Star School
- SCP-3532 - Merch Link in Bio
- SCP-3533 - Metaphysiclean!
- SCP-3534 - Doomsyesterday
- SCP-3535 - Casus Lignum
- SCP-3538 - THE GREATEST CARABINER EVER
- SCP-3539 - So That Others May Live
- SCP-3540 - Don't Queer the Reaper
- SCP-3541 - Twice as Bright
- SCP-3542 - "Fear Not, Citizen!"
- SCP-3543 - One, Two, Four
- SCP-3544 - Home is Where the Heart Was
- SCP-3545 - The Places You'll Never Go
- SCP-3547 - A Dream of Our Beloved
- SCP-3548 - We exist, but only in your mind
- SCP-3549 - Sweet Medieval Bitcoin
- SCP-3550 - Cancer of Passion
- SCP-3551 - Dr. Wondertainment's Inflatable Invasion
- SCP-3553 - They All Go Into the Dark
- SCP-3554 - No. 4 Borscht Canning Factory
- SCP-3555 - Attempted Suicide
- SCP-3557 - CK or OK?
- SCP-3559 - Best Thing Since
- SCP-3563 - Lemonabe, 25¢!
- SCP-3564 - The Immortal Bard, Act Ⅱ: Return of Shakespeare
- SCP-3566 - Not Even That Funny
- SCP-3567 - Chrono-Wrap
- SCP-3568 - Shapes
- SCP-3569 - Buuny Butler
- EE-3570 - Umbral Ultimatum
- SCP-3571 - OLLIE'S OBSTACLE COURSE OF OBVIOUS OBLITERATION!
- SCP-3572 - Sand Cave
- SCP-3574 - Lambs to the Slaughter
- SCP-3575 - It's a Small Town
- SCP-3576 - Think But This And All Is Mended
- SCP-3577 - Pack To The Future
- SCP-3578 - A Mother's Love
- SCP-3579 - Insta-Gator
- SCP-3580 - The Devotion Locket
- SCP-3581 - Corneliu
- SCP-3582 - The Multiverse is Having a Seizure
- SCP-3583 - Hellbus
- SCP-3584 - Mechanical(?) Dandelion Garden
- SCP-3585 - Wondertainment's Murder Mystery Mates
- SCP-3588 - Cheers
- SCP-3590 - A Dirge for the Silent
- SCP-3591 - The Fallen Giant
- SCP-3592 - Kindertransport
- SCP-3593 - Scooby Snacker
- SCP-3594 - Genesis Ulcer
- SCP-3595 - Einheit
- SCP-3596 - Super Justice Containment Action Squadron
- SCP-3598 - Bishop's Glen Memorial Park
- SCP-3599 - A Hard Day at Work
3600-3699
- SCP-3600 - Documenting Doomsday
- SCP-3601 - A Cautionary Tale
- SCP-3602 - The Monkey King's Legacy
- SCP-3604 - Craydaddy
- SCP-3605 - The blue is so beautiful
- SCP-3606 - Praise You
- SCP-3607 - Residence Evil
- SCP-3608 - PTSD: Post-Traumatic Stress Dimension
- SCP-3609 - Hati Hróðvitnisson
- SCP-3611 - The Yamauchi Deck
- SCP-3612 - The Mainlist is Out of Order; Please Try Again
- SCP-3613 - Things You People Wouldn't Believe
- SCP-3614 - Your Reality
- SCP-3615 - Depressed Divine Demon of Diptera & Diarrhea
- SCP-3616 - Writer's Block
- SCP-3617 - The Parasites of Normal
- SCP-3618 - Supply and Demand
- SCP-3619 - You Spin Me Right Round, Baby, Right Round
- SCP-3620 - Data Expunged the Chicken
- SCP-3621 - Best Intentions
- SCP-3622 - Agile, Handle with Care
- SCP-3623 - She was my muse
- SCP-3624 - Crazy Chimera Lady
- SCP-3625 - The Great American Meme Machine
- SCP-3627 - Dreamy Jasters
- SCP-3628 - Better Not to Know
- SCP-3629 - Spinder
- SCP-3630 - Reverse Locked Room Mystery
- SCP-3631 - A Man and his Monster
- SCP-3632 - Nibirdu
- SCP-3634 - In Vino Veritas
- SCP-3635 - The Forgotten Archive
- SCP-3636 - World's Greatest Jukebox
- SCP-3638 - You can't be serious!
- SCP-3639 - What-A-Boots
- SCP-3641 - Remember
Apollo-99Nased - SCP-3642 - T(r)opical Cream
- SCP-3643 - Part 1: ANOMALY IS THE MOST DANGEROUS ANIMAL
- SCP-3644 - Slot reserved, please do not fill
- SCP-3645 - Star Child
- SCP-3646 - Phantom Mosquitos
- SCP-3647 - Quousque Tandem?
- SCP-3648 - Buga and Buninka
- SCP-3650 - Travel Bug
- SCP-3651 - Chalk Children
- SCP-3652 - Inverting Box
- SCP-3653 - A Calendar with Extra Days
- SCP-3654 - WarTime
- SCP-3655 - The Last Resort
- SCP-3656 - Governments in Exile
- SCP-3657 - Posthumous Hero
- SCP-3658 - The Time Walker
- SCP-3659 - Rubbery Triceratops Gauntlet
- SCP-3660 - The Zoo Zipper
- SCP-3661 - A Toy Story
- SCP-3662 - The Doomsday Clock
- SCP-3665 - Instant Demon, Just Add Blood!
- SCP-3666 - Repairing the Mask
- SCP-3667 - All's Well that Ends Hell
- SCP-3668 - Provenance
- SCP-3669 - A Mathematics Self Help Book
- SCP-3672 - Why are there so many songs about rainbows?
- SCP-3673 - But when the door is closed…
- SCP-3674 - The Loss of Sector H
- SCP-3675 - The Void Called
- SCP-3676 - The Multiversal Megapede
- SCP-3677 - Paradix High School: Paradise for the Paranormal
- SCP-3678 - "It's Not That Anomalous."
- SCP-3679 - Make a Geas, Foundation
- SCP-3680 - The White Guys
- SCP-3681 - 5 - 0
- SCP-3682 - Parousia
- SCP-3683 - Dire Pigeons
- SCP-3684 - Pump You Full Of Lead
- SCP-3685 - The Fractured Pile
- SCP-3686 - Evan Deserves to be Remembered
- SCP-3687 - Anti-Entropy Doorknobs
- SCP-3690 - Abdominal Pains
- SCP-3691 - Medium Rare
- SCP-3692 - the notebook
- SCP-3694 - America's Diner Is Always Open
- SCP-3697 - "Let Me Redirect You Right Now"
- SCP-3698 - Fresh Pine
- SCP-3699 - Memoirs of a Shingle Beach
3700-3799
- SCP-3701 - All the Time in the World
- SCP-3703 - From Death, We Contain
- SCP-3704 - Requiem
- SCP-3705 - The Gardener's Shadow
- SCP-3706 - 50,000 Krakens Under the Sea
- SCP-3709 - Intended Purpose
- SCP-3710 - Elon MUSH!
- SCP-3711 - Suffering On The Rising Tide
- SCP-3712 - Grandma Knows Best
- SCP-3713 - All the World’s a Stage
- SCP-3714 - Jiangshi's Ring
- SCP-3715 - Not So Subtlє Teα
- SCP-3716 - Boned Beyond Belief
- SCP-3718 - An Environmental Cat-astrophe
- SCP-3719 - Your Friendly Neighbourhood Lawnmower
- SCP-3720 - Smiting on a Budget
- SCP-3721 - Obsolete Weapons System
- SCP-3722 - The City That Was Half the World
- SCP-3723 - The Orca-stra
- SCP-3724 - Guard Puppies
- SCP-3725 - Ironically, I don't have a Good Idea for a Title
- SCP-3726 - AnthropomorFic
- SCP-3727 - Syringe Man
- SCP-3728 - STOP. HAMMERTIME
- SCP-3729 - The Best Day of Your Life
- SCP-3731 - Normality Will Be Protected
- SCP-3734 - Muddy Morphing Power Worms!
- SCP-3735 - ForbiddeN SouNd
- SCP-3736 - Talk It!
- SCP-3738 - Casting Lots
- SCP-3739 - Mind-Milk™ by Moosphere, Inc.
- SCP-3741 - The World Is Your Oyster
- SCP-3742 - A "Live" Album
- SCP-3743 - Euboea, Son of Briareos
- SCP-3744 - Dungeons And D-Class Personnel
- SCP-3745 - As the Heart Breaks, so do the Heavens
- SCP-3747 - Death by Vacuum
- SCP-3748 - Bowl of Flies
- SCP-3750 - A White Fish
- SCP-3751 - Skip's Gambit
- SCP-3752 - Cold From Within
- SCP-3753 - TEA-K.O.
- SCP-3754 - Pocket Pet Collector Plus!
- SCP-3755 - Guess How Many
- SCP-3756 - In Space, No One Can Hear Yee-haw!
- SCP-3757 - Cocoon Park
- SCP-3758 - The Last Dodo
- SCP-3761 - The War of the Squirrels
- SCP-3762 - Shelter from the Storm
- SCP-3763 - A Piece of Him is Still Around
- SCP-3766 - Reverse Cargo Cult
- SCP-3767 - Additional Baggage Fee
- SCP-3768 - Three Moons Public Radio
- SCP-3769 - Evolutionary Rescission Device
- SCP-3770 - One Thousand Footsteps Towards The Promised Land
- SCP-3771 - Americans Be Eating Cheesed Burger
- SCP-3772 - 😂 WHO DID THIS 😂
- SCP-3773 - 9,000 Lives
- SCP-3774 - My Heart DEETs Faster For You
- SCP-3776 - Camp Nimrod
- SCP-3778 - We Are Possum. We Are Legion.
- SCP-3779 - A Greenhouse: Or, How D-80801 Learned To Give In And Embrace Nature
- SCP-3781 - OK ペインター!
- SCP-3782 - Through Roosevelt's Glasses
- SCP-3783 - Baba Yaga's Cottage
- SCP-3784 - High Octane Nightmare Fuel
- SCP-3785 - Jasper's Hill
- SCP-3786 - Chubby Dog
- SCP-3787 - The Horse Meme
- SCP-3791 - An Entirely Standard and Uneventful Anomaly
- SCP-3792 - Up In Smoke
- SCP-3793 - Spectral Punk Drive-By
- SCP-3798 - There Are Flowers There
3800-3899
- SCP-3800 - Many Grandparents Ago
- SCP-3801 - Based on a True Story
- SCP-3803 - Custom-Made Business Cards, On the Go!
- SCP-3804 - Communiqués from the Apocalypse
- SCP-3805 - The Birth Of The World
- SCP-3807 - A Real Bad Hombre
- SCP-3809 - Love in the Time of Algorithms
- SCP-3810 - [UNTITLED]
- SCP-3811 - A Therapist Needs A Therapist
- SCP-3814 - Tag! You're it!
- SCP-3816 - Blue Light
- SCP-3818 - Two Favours One
- SCP-3819 - Box of Desire
- SCP-3820 - Sitting and Caring for Pets
- SCP-3821 - Stuck In the Mailroom
- SCP-3822 - K-PARTY
- SCP-3823 - Put On Your Red Shoes
- SCP-3825 - So it Goes
- SCP-3826 - The Definition of Technophobia
- SCP-3828 - A Powerful Seal
- SCP-3829 - Metastasis
- SCP-3831 - Can't Call Out
- SCP-3832 - Surprise Pillow Fight
- SCP-3834 - Fossil Records
- SCP-3835 - Better inWeedients, Better Pizza, Papa John's
- SCP-3836 - Grease Monkey And The Search For FAST
- SCP-3837 - Corn Goblin
- SCP-3838 - Nomads of the 4th-Dimensional Steppe
- SCP-3839 - Liposlugtion: 2 Fat 2 Furious
- SCP-3843 - Sam
- SCP-3845 - Buddy
- SCP-3846 - Walden Pond Scum
- SCP-3848 - History Exists for the Memorable
- SCP-3851 - You May Not Be Able To Drown Your Demons, But The Demons Can Drown Your Screams
- SCP-3852 - Small Town Justice
- SCP-3853 - Imperium
- SCP-3854 - Belly of the Playwright
- SCP-3857 - Call of the Tropic
- SCP-3858 - Hugbox
- SCP-3861 - Self-Reflection
- SCP-3864 - I've Been Framed!
- SCP-3865 - You Reap What You Sow
- SCP-3868 - Constitution Saving Throw
- SCP-3869 - High Quality Ripoff
- SCP-3870 - The Ice-Cream Vigilante
- SCP-3871 - Dr. Wondertainment's Allegorical Anomaly-Annihilating Assault Automaton
- SCP-3872 - Consult an Alchemist
- SCP-3873 - Unbearable Treatment
- SCP-3875 - Spyders
- SCP-3876 - Tussie Mussie
- SCP-3877 - MIЯЯOЯ BÄR
- SCP-3878 - Words Will Never Hurt Me
- SCP-3879 - Musical Jolly Ape™ by Dr. Wondertainment
- SCP-3880 - ILLEST RAIN SOUNDS ∞ Hours No Looping - White Noise, Nature/Healing/Ambient, Meditation/Insomnia/Study ASMR [ORIGINAL]
- SCP-3884 - Gunmetal Gary Puts the Peddle to the Metal
- SCP-3885 - The High-Octane Full-Throttle Adventures of the Exploding Zombie Gearheads
- SCP-3886 - The Necromancer’s Saddle
- SCP-3887 - Monster under the bed
- SCP-3889 - The Greatest Fisherman Who Ever Lived
- SCP-3891 - Paradise Lost and Found
- SCP-3893 - I'm Going to Have a Motherfucking Meltdown
- SCP-3894 - Our Sorrow
- SCP-3895 - Our Unrest
- SCP-3896 - We'll Never Stop Eating Big Gordo
- SCP-3897 - Mother's Eye Is Upon You
- SCP-3898 - The Burden
3900-3999
- SCP-3909 - Wu Tang Clan Ain't Nuthing ta Fuck To
- SCP-3910 - A Comedy
- SCP-3912 - Final Memories Through The Lens
- SCP-3914 - Necrocapitalism
- SCP-3915 - Gay Trashman
- SCP-3916 - Hungry Locusts
- SCP-3917 - Beetles in a Jar
- SCP-3918 - To Starve Her Highness
- SCP-3919 - In Memoriam
- SCP-3921 - Greco-Roman Atmospheric Reconstruction
- SCP-3923 - Negotium Ficus
- SCP-3924 - Silent Honour Ark
- SCP-3925 - It's All Papers and Forms
- SCP-3926 - Saturday Evenings with your host, Tyal'k'nec!
- SCP-3927 - The Fancy Mouse
- SCP-3928 - Eliphalet Remington Can Kiss My Ass
- SCP-3931 - The End of Days
- SCP-3935 - This Thing a Quiet Madness Made
- SCP-3938 - Dr. Wondertainment's Take-You-Anywhere Machine
- SCP-3939 - [NUMBER RESERVED; AWAITING RESEARCHER]
- SCP-3941 - The Major Occultation
- SCP-3943 - Taco Man
- SCP-3944 - Memory Is Fleeting
- SCP-3945 - Big Huge Nightmare Panther
- SCP-3946 - Amphitrite's Curse, Scylla's Wrath
- SCP-3948 - The Man in the Mirror
- SCP-3950 - FULL THROTTLE AXOLOTL
- SCP-3951 - Doggone It
- SCP-3953 - Costa Rica… IN SPACE
- SCP-3954 - Scarecrow's Secrets
- SCP-3956 - The Mealworm Song
- SCP-3957 - The Eternal Soviet Prison
- SCP-3958 - Little Brother
- SCP-3959 - The End of All Knowledge
- SCP-3962 - Agasesdi's Gift
- SCP-3963 - I Contain Multitudes
- SCP-3964 - Suicide Staircase
- SCP-3965 - Zhulong
- SCP-3967 - All Watched Over By A Machine Of Loving Grace
- SCP-3968 - Immoral Minefield
- SCP-3969 - Hofmann's Nightmare
- SCP-3970 - i want to contain too
- SCP-3971 - Utility Closet SB3-117a
- SCP-3972 - "Ken Burns Presents: SCP-3972"
- SCP-3973 - Would you like to re-roll?
- SCP-3974 - Such Sweet Sorrow
- SCP-3975 - Save the Oreos
- SCP-3977 - Hawaiian Punch
- SCP-3978 - The World Is Going Away
- SCP-3981 - [UNTITLED UFO]
- SCP-3982 - The Devourer of Filth Would Like to Be Friends With You
- SCP-3983 - To Petition the Dead
- SCP-3985 - Focus of a Regulatory Dispute
- SCP-3986 - The Observatory of Genghis Khan
- SCP-3987 - Purifying Exclamation
- SCP-3988 - Napoleon Bonyparts, Superstar Skeleton
- SCP-3989 - The Bone Orchard
- SCP-3990 - Deer in the Headroom
- SCP-3991 - "Lewis Island"
- SCP-3992 - Wondertainment Whacky Halloween Fun Masks!
- SCP-3993 - Smart WIFI
- SCP-3994 - Normal Human People
- SCP-3996 - The Tangential Frontier
- SCP-3997 - In My End Is My Beginning
Объект №:
Класс объекта: Нейтрализован
Особые условия содержания: Я не покину это место.
Описание: Дело сделано.
Думаю, прежде чем оно меня настигло, я прошла мили, километры, пофиг, какая нахуй разница. На этот раз оно притворилось облаком, я обернулась ровно в тот момент, когда оно развернулось аки подарок на новый год. Я прямо чувствовала, как у него слюни текут, хоть оно на это и не способно. Ух как оно жрать хотело.
Когда оно напало, я ударила ножом, и оно завизжало как свинья. Да, вот так просто. Оно не то отпрыгнуло, не то проскользнуло назад по земле, оставив на песке след чего-то, на что больно было смотреть.
Оно опять напало, я снова ударила.
И опять.
И ещё раз.
Мы друг в друге наделали дыр. Я — в его теле, оно — в моём разуме. От меня осталось не очень много.
Несколько минут оно корчилось на земле и вворачивалось само в себя. Я продолжала бить. Оно не кровоточило, но мои руки будто бы намокли. Возможно, оно не было живым в том же смысле, что и я. Возможно, какая-то метафизическая хуйня.
Удар удар удар. Оно умерло свернувшись в маленький чёрный шарик размером с мой большой палец. Мягкий и податливый. Я раздавила его ботинком.
Раз это так просто, чего ж я не сделала так раньше? Сделай я это сразу и во мне осталось бы побольше от моей личности. Может, на то была причина, но я её уже не помню.
Пчела умирает, когда жалит. Возможно, Мимик был похожим в этом отношении. Его последний удар, прежде чем я его прикончила, был каким-то иным. Раньше оно сразу забирало конкретные воспоминания. Сейчас же я как будто бы корабль с пробоинами, в который заливается вода. Или, в моём случае, выливается из него. Не очень сравнение, если честно.
Корабль как Титаник! Я это помню. Я помню Титаник. Титаник был кораблём, который потонул после столкновения с ледником и
Я что-то забыла. Не помню слова, которые были до этого. Оно всё пропадает.
Я могу себя убить, у меня при себе нож. Не самый приятный способ самоубийства, но я бы могла разрезать себе горло. Но вот в чём дело: я не хочу умирать. Гляжу на вечно слоняющихся здесь людей, ослепших от постоянного открытого взгляда на солнце, и думаю только о том, что не хочу умирать.
Я всё ещё могу это сделать. Время ещё есть. Так просто. Я могу. Просто это сделать, мне только надо
Я
Я
Я
Я не понимаю, что значат эти слова.
я не хочу исчезнуть.