Random Fragments

О5-11Page1.png

О5-11Page2.png

О5-11Page3.png

О5-11Page4.png

О5-11Page5.png

О5-7Page1.png

О5-7Page2.png

О5-7Page3.png

О5-7Page4.png

О5-7Page5.png

Содержание
Корейский филиал
Китайский филиал
Французский филиал
Польский филиал
Испанский филиал
Тайский филиал
Японский филиал
Немецкий филиал
Итальянский филиал
Украинский филиал
Португальский филиал
Чешский филиал
Традиционный Китайский филиал
Вьетнамский филиал

Корейский филиал

Codename: scka - Defense mechanism
Codename: L.H. Sein - By people
SCP-002-KO - Xianess' fountain
SCP-003-KO - Farmhouse
SCP-004-KO - Eraser Phenomenon
SCP-005-KO - Mush-Room
SCP-006-KO - Killer Bed
SCP-010-KO - Honest Scam Calls
SCP-011-KO - The Sleeping Giant
SCP-014-KO - Ask Anything
SCP-021-KO - The sage's book
SCP-022-KO - The magnifying glass
SCP-033-KO - Print Foundation Documents With Caution
SCP-034-KO - Wolf Flower
SCP-048-KO - Science Club
SCP-049-KO - The Black Parade
SCP-050-KO - About SCP-050-KO
SCP-056-KO - ［ WARNING: DO NOT READ THIS PAGE! ］
SCP-064-KO - Seoul Cinematic Production
SCP-072-KO - Absolute Taste
SCP-077-KO - The Bermuda Triangle Underwear
SCP-079-KO - Containment-longing Shuttles
SCP-086-KO - Knives for Vegans
SCP-111-KO - A Small Error
SCP-112-KO - "Dog" Soju
SCP-113-KO - Eternal Thursday
SCP-114-KO - LED Fen Fire Flies
SCP-115-KO - "Meaningless" Regular Polyhedron
SCP-118-KO - The Savior of All
SCP-132-KO - Bawling Bamboo
SCP-137-KO - The Bad Land
SCP-149-KO - CC BY-NC-ND
SCP-153-KO - Read me before read below
SCP-154-KO - Read me before read above
SCP-157-KO - No time to go to the toilet
SCP-159-KO - Peach Blossom Land
SCP-168-KO - Stir-fry?
SCP-169-KO - The Volition Wins The Day
SCP-171-KO - Forgotten Music
SCP-185-KO - Visual Novel
SCP-188-KO - Heart of the Earth
SCP-189-KO - Dark alleyway
SCP-212-KO - Rusty Spade
SCP-217-KO - USS Enterprise
SCP-222-KO - A Train in Flames
SCP-229-KO - Quadrennial
SCP-234-KO - Doing Dootie Duty
SCP-268-KO - STRUCTURE ERROR
SCP-299-KO - A Murder of Crows
SCP-310-KO - Foods From That Far Place
SCP-321-KO - Fade-in Virus
SCP-326-KO - Natural reality fixation
SCP-345-KO - The Space Hero
SCP-380-KO - Now the test begins.
SCP-412-KO - [DATA NOT EXPUNGED]
SCP-416-KO - There is an instrument buried under the oak tree.
SCP-432-KO - The Child Gifted With Immortality
SCP-444-KO - Avici
SCP-499-KO - The real "BGM"
SCP-500-KO - The only cure
SCP-503-KO - Normalcy Classification System
SCP-505-KO - The Schoolbag
SCP-521-KO - What is Seeing?
SCP-545-KO - The Non-Flying Dutchman
SCP-602-KO - I want to be myself for once
SCP-621-KO - I will live in ██
SCP-650-KO - The Duty to Stop All Sin and Unhappiness On This World
SCP-689-KO - Fangi
SCP-702-KO - Grownups Don't Know
SCP-709-KO - Dismembered Eternity
SCP-713-KO - Gods of the Flying House
SCP-750-KO - Revenant Soldier
SCP-755-KO - Learn all the technology and knowledge you want; there are Other Important Things
SCP-774-KO - Planet Indra
SCP-797-KO - Skyfall
SCP-809-KO - Along the thorny vines
SCP-817-KO - Flame of Love
SCP-819-KO - Open the Curtains, Lights on
SCP-824-KO - 22×6×10²³ drops of water
SCP-825-KO - Sokcho Tongkeun Mulhoe Restaurant
SCP-826-KO - Homo Sapiens
SCP-827-KO - It's Beginning to Smell a Lot Like Christmas Everywhere I Go
SCP-828-KO - A Door Locked from the Inside
SCP-829-KO - MAD man
SCP-830-KO - 's slippers
SCP-841-KO - Supervisor: Antimeme Expert Lee Hanseok
SCP-876-KO - Head Siren
SCP-877-KO - B████d B████s
SCP-890-KO - Here be We, the Consequence of Your Actions
SCP-897-KO - [ASMR] Dentistry / Teeth Extraction Relaxing Sound
SCP-903-KO - Not Steroids!
SCP-916-KO - Perfectly Replaces the Biological Patriarch
SCP-923-KO - The Anti-Disney Department
SCP-953-KO - Pretending Humanoid
SCP-973-KO - Man With Gun
SCP-980-KO - Cloudy with a Chance of People
SCP-997-KO - The Edge of Esotery
SCP-516-KO-EX - [DATA REDUCED]
SCP-7891-KO-EX - Amnestic Mushroom
SCP-001-EX-KO-J - A Bad Boy
SCP-1004-KO-J - Girls' Magic Wand
SCP-none-KO-J - It's an annoying clothes hanger!

Китайский филиал

CODE NAME: Darkequation - Bamboo Scroll
CODE NAME: Anglia - Dragon Vein
CODE NAME: Veleafer - 演绎部
CODE NAME: Re_spectators - Substitution Reaction
SCP-CN-009 - Question, Solve, Answer
SCP-CN-010 - Aye-aye
SCP-CN-026 - No Longer be Alone
SCP-CN-048 - A Failed Attempt
SCP-CN-066 - OMG! What the Foundation Has Failed to Do for 20 Years Was Done by SCP-CN-066 in Just 4 Seconds…
SCP-CN-096 - "Stop" "Door"
SCP-CN-111 - The Solitary Venerable One
SCP-CN-114 - Pine of Awakening Smoke
SCP-CN-121 - The Badge of Dr. Sun Yat-sen
SCP-CN-, 00122 - Fifthist Memetics
SCP-CN-145 - Hometown
SCP-CN-161 - Interpreter
SCP-CN-166 - Embryos
SCP-CN-171 - Dormitory Manager
SCP-CN-176 - Uncle Sweets
SCP-CN-180 - SPEEDCORE GENERATOR!!!
SCP-CN-204 - Thunder Trial
SCP-CN-233 - Dot Matrix
丂匚卩句丹丂卄匚几句丹丂卄丅山口几丨几乇丂丨乂 - 卄丹几乙丨从乇从乇
SCP-CN-312 - What Does She Know?
SCP-CN-326 - ~~In Fading Books~~ A Digital Music Fantasy Is Reborn
SCP-CN-366 - Exist
SCP-CN-369 - Self-Declaration Rostrum
SCP-CN-404- Memetic Immunity Disease
SCP-CN-412- Beauty Camera
SCP-CN-440- Immortals of the Table
SCP-CN-444 - Heavenly Sounds
SCP-CN-445 - A Failed Anomalous Document
SCP-CN-475 - Entombing
SCP-CN-514 - Insomnia
SCP-CN-529 - No Longer Human
SCP-CN-534 - Mr. Dialect
SCP-CN-546 - Our Secrets
SCP-CN-661 - Dick, St. Dick
SCP-CN-666 - Hold the Bottom Line
SCP-CN-673 - A bunch of statues what move when you dun look at dem
SCP-CN-675 - The Great Kyet Khaewt Device
SCP-CN-678 - Stranger
SCP-CN-713 - Keyboard Fish
SCP-CN-717 - Throat Forest
SCP-CN-731 - Black Sunset
SCP-CN-756 - Book of Numbers
SCP-CN-757 - Tiny World
SCP-CN-758 - Mini-Foundation
SCP-CN-767 - Chart Syndrome
SCP-CN-797 - The Wandering Train
SCP-CN-805 - Magic: The Gathering
SCP-CN-810 - "Gold Foil"
SCP-CN-829 - Spherical Potatoes
SCP-CN-844 - The Seed of Lovesickness
SCP-CN-861 - The pedestrian in a painting
SCP-CN-879 - Programmable Office Building
SCP-CN-918 - ~~Ever-Drifting~~ Paper Plane
SCP-CN-937-J - A Useful Toilet
SCP-CN-964 - I'll turn on the Bluetooth and listen to some tunes
SCP-CN-985 - Exam Shark
SCP-CN-999 - Spreading Your Wings
SCP-CN-1000 - 2300
SCP-CN-1001 - Writing Ends Here
SCP-CN-1050 - "Aquarius"
SCP-CN-1076 - "Have another bottle"
SCP-CN-1080 - A Silent Bell
SCP-CN-1099 - ~~Tin of Sardines~~
SCP-CN-1123 - CTTGGGAGATGAATAGATGGGTTGCAACCCATCTATT……
SCP-CN-1138 - Anime Must Be Destroyed
SCP-CN-1145 - A Nonexistent Elevator
SCP-CN-1174 - Royal Quiet Deluxe Typewriter
SCP-CN-1256 - SCP Foundation Chinese Branch Chronicle
SCP-CN-1260 - Origin of Species, or Machinery of Creation
SCP-CN-1276 - "Zekkōchō Conveyor Belt Sushi Restaurant!"
SCP-CN-1391 - hamster pill by dado
SCP-CN-1409 - 4200006200
Work Notes: SCP-CN-1417
SCP-CN-1424 - not spicy mouthwash by dado
SCP-CN-1463 - Catgirl Training Plan
SCP-CN-1483 - Those distant, cold stones
SCP-CN-1500 - pʰoʃma
SCP-CN-1537 - Storytelling
SCP-CN-1604 - A Gun That Gets More Powerful As It Kills More People
SCP-CN-1621 - become cat pill by dado
SCP-CN-1666 - Veilbreak
SCP-CN-1691 - A machine looking for loved ones
SCP-CN-1733 - The Empty Patches of Sky
SCP-CN-1767 - What is Papa's Mama Called?
SCP-CN-1780 - Red Light, Green Light
SCP-CN-1831 - Human-repelling Incense
SCP-CN-1835 - The day the music died. Except for you.
SCP-CN-1837 - USB Sword
SCP-CN-1920 - J-Q-X, three brothers, see fish eyes and dig them out
SCP-CN-1976 - Little Red Book
SCP-CN-1987 - Plunger
SCP-CN-1997 - When Magic and Science Intersect
SCP-CN-2019 - Forbidden Borderline Θ
SCP-CN-2035 - Terminal Entertainment!
Riddle-2109: God
SCP-CN-2176 - Zero-Calorie Biscuits
SCP-CN-2200 - Hyper Dimension Action
SCP-CN-2215 - A Literary Opinion
SCP-CN-2227 - Drunk Alone
SCP-CN-2270 - Rainbow Mount
SCP-CN-2300 - 1000
SCP-CN-2304 - The Sun is Tired of Rising
SCP-CN-2345 - Memory-Carrying Enoki
Observation File #CN-2380 - When Spring Comes
SCP-CN-2399 - Still Raining
SCP-CN-2401 - Sick Hall
SCP-CN-2402 - The Star Nearby
SCP-CN-2403 - Dodgeball
SCP-CN-2405 - Ronald McDonald
SCP-CN-2406 - … would much rather have KFC!
SCP-CN-2426 - McNugget Fundamentalism
SCP-CN-2440 - A video of torturing tubers
SCP-CN-2517 - A Man Who Can~~not~~, In Fact, Fly
SCP-CN-2620 - Birthday
SCP-CN-2626 - D4C
SCP-CN-2631 - Aliens Speaking English
SCP-CN-2636 - MTF-己申-20 ("We")
SCP-CN-2740 - ~~Addictive Minecraft, Sentient NPCs~~, Digital Lies, Longing for Reality
SCP-CN-2752 - I See the Machine Core Before the Mechanical Revolution
SCP-CN-2781 - Before Sleeping
SCP-CN-2806 - Slickness
SCP-CN-2835 - Where am I?
SCP-CN-2878 - Very Annoying Mosquitoes
SCP-CN-2879 - Very Big Strainer
SCP-CN-2880 - Very Sharp Sword
SCP-CN-2918 - The Pleasant Sound of Rain
SCP-CN-2926 - Big Prime Number
SCP-CN-2980 - Your Copper Sulfate Friend
SCP-CN-2987 - Don't Look Up
SCP-CN-2989 - DEMONSTRATION OF THE PRECENCE
SCP-CN-2991 - Why disbelieve ye in the revelations of Anormaly, when ye bear witness
SCP-CN-116-EX - A Dazzling, Lively Relic
SCP-CN-3300-EX - The Lamb has Died
SCP-CN-123-J - How Many Urinals Do We Need?
SCP-CN-213-J - The Magical Geoduck
SCP-CN-404½-J - "The Foundation is FAKE!"
SCP-CN-421-J - The Great Radish
SCP-CN-555-J - Hurts Like Hell!
SCP-CN-666-J - Mew Mew Mew
SCP-CN-963-J - Extremely Annoying Codes
SCP-CN-1616-J - WTF YOU SAID YOU DIDNT REVIEW
SCP-CN-2000-J - Foundation's Bizarre Black-Technologies
SCP-CN-2719-J - "Waifu"

Французский филиал

CODE NAME: Dr. Gray - Not all angels have wings
CODE NAME: Dr. Johannes - Program Xibalba
SCP-014-FR - Agent of Chaos
SCP-021-FR - Lights of the Cliffs
SCP-027-FR - "Get Rick Rolled"
SCP-031-FR - The Knowledge-Eaters
SCP-043-FR - Blind Wanderer
SCP-045-FR - Thieving Arthropod
SCP-059-FR - Blizzard's Claws
SCP-060-FR - The Lich
SCP-061-FR - The Kiwi
SCP-073-FR - Biological Sterilizer
SCP-089-FR - The Athena Project
SCP-095-FR - The Demon Core
SCP-113-FR - ~~Infected file~~ S.O.S. - Dr. Anton Vehan
SCP-116-FR - Trabant 601 S "Hermes"
SCP-125-FR - Mark IV
SCP-137-FR - The One True Religion
SCP-143-FR - Mesozoic chicken coop
SCP-150-FR - Vox
SCP-155-FR - Wake up
SCP-161-FR - The Book And The Beast
SCP-164-FR - Creationism
SCP-172-FR - "Points of View"
SCP-181-FR - Non-recyclable
SCP-185-FR - Kinetic Inverter
SCP-192-FR - Your question
SCP-197-FR - Gardener Tortoises
SCP-198-FR - Considerations on the Causes of the Greatness of Mankind and its Decline
SCP-201-FR - Mind Palace Syndrome
SCP-213-FR - The Vagabonds of the Dark Forest
SCP-215-FR - Industrial Sardine
SCP-218-FR - The Antiquity Manufacturer
SCP-227-FR - Horoscomaton®
SCP-233-FR - The Pillow That Makes You Sleep
SCP-237-FR - Absurd Instability
SCP-281-FR - The Day The Earth Stopped Being Flat
SCP-291-FR - Containment Procedures Updated
SCP-296-FR - Dusk on Mars
SCP-299-FR - 113-B
SCP-320-FR - Life is a pillow
SCP-324-FR - He Died Thrice
SCP-327-FR - Foresight Cameras
SCP-335-FR - Lacrymodjinn
SCP-347-FR - Risky Driving
SCP-361-FR - Matriarch
SCP-375-FR - Proof of the existence and uniqueness of the Self
SCP-400-FR - She's Too Beautiful to be True
SCP-403-FR - Güiro in Exile
SCP-418-FR - Maurice the Concept-Eating sheep
SCP-445-FR - Monkey See, Monkey Shoot
SCP-466-FR - The Cottage Pottage
SCP-471-FR - Riders on the Storm
SCP-476-FR - Molecular Voodoo Dolls
SCP-484-FR - Billy the Euc-kid
SCP-503-FR - An Imperfect Allegory
SCP-505-FR - Before Aleph
SCP-510-FR - 5 Stars
SCP-540-FR - The Grass is greener
SCP-555-FR - The SCP Religion
SCP-569-FR - Dimensional gloryhole
SCP-589-FR - The Lamppost Song
SCP-192-FR-J - Chicken that runs like really really fast
FCP-676-FR-Vay - Exftremely Danverouf Viruf
SCP-1054-FR-J - Schisms
SCP-SKIP-FR-J - Skip For Long Optimal Multifunction Whiteness ©

Польский филиал

CODE NAME: ZeroStrider — Wingless Birds
SCP-PL-007 - Happily nonexistent object
SCP-PL-023 - Written World
SCP-PL-030 - The Mulch
SCP-PL-037 - The Haunter
SCP-PL-052 - Subtemporal bracer
SCP-PL-057 - Leccinum Disappearing
SCP-PL-066 - Trapdoor in a storeroom
SCP-PL-067 - Dog that traveled in time
SCP-PL-078 - Earrings of Instant Meetup
SCP-PL-086 - I know about the Foundation
SCP-PL-091 - Calcumuttons
SCP-PL-144 - Analogue Virtual Reality
SCP-PL-149 - The Cinema
SCP-PL-150 - On vacations
SCP-PL-152 - Pet snakes
SCP-PL-160 - Fat Burner
SCP-PL-166 - Cemetery lights
SCP-PL-173 - Fungal sounds
SCP-PL-174 - R'EALITYBLENDER™
SCP-PL-180 - Those who embark with us
SCP-PL-183 - Lust of Speed
SCP-PL-186 - Art is Death
SCP-PL-195 - Gift from a friend
SCP-PL-200 - Responsible Reading
SCP-PL-203 - Weather for 2033
SCP-PL-204 - How to Disappear Completely and Never Be Found
SCP-PL-213 - Gloria Necatis
SCP-PL-231 - The Wrath of Perun
SCP-PL-248 - Heraclitic Tears
SCP-PL-253 - WHAT IN THE KENTUCKY FRIED FUCK
SCP-PL-259 - The list of territories conquered by Genghis Khan is incomplete, you can help by expanding it
SCP-PL-260 - We know where you live
SCP-PL-262 - A
SCP-PL-267 - Mieszko, Mieszko, mój koleżko
SCP-PL-284 - Oh God, oh fuck
SCP-PL-289 - A Multidimensional Solution For Shopping at Biedronka
SCP-PL-290 - Empiricism
SCP-PL-121-J - Diego the Turtle
SCP-PL-2004-J - The very fast vehicle of anthropomorphic amphibian
SCP-PL-2021-J - The hope for our world
SCP-PL-6470-J - Cat meme [DANGEROUS]

Испанский филиал

CODE NAME: Uncle Nicolini - The Nexus of Babel
SCP-ES-038 - The Bussinesman
SCP-ES-039 - Satellipeople
SCP-ES-040 - Polaris Leporidae
SCP-ES-044 - Necrofauna Arthropoda
SCP-ES-048 - The Power of Ideas
SCP-ES-054 - The Garden Gnome Gardeners
SCP-ES-058 - Stilhed Overalt; Silence Everywhere
SCP-ES-059 - Thirteen Little Fingers
SCP-ES-069 - The Twine upon the Fate of her Appeal to Look
SCP-ES-070 - Narcissus and the Plain of the Arrows of Eros
SCP-ES-076 - https://www.youtube.com/watch?v=fgm14D1jHUw
SCP-ES-081 - Gluttony
SCP-ES-083 - deCipher'em All v1.6
SCP-ES-087 - Sandbox; Intentional Continental Drift; I don't know biology so I'll turn fish into birds.
SCP-ES-089 - The Last Emperor of Hoiohiña
SCP-ES-090 - Nine Lights Emissary
SCP-ES-091 - Eugenics Nightmare
SCP-ES-095 - A Victimless Crime
SCP-ES-096 - THE GALLEON, or; Hunt the Dutchman! Or; The Assfuckedship
SCP-ES-097 - Fungi Reactor
SCP-ES-098 - Kynodontos
SCP-ES-099 - The Piano Concert
SCP-ES-100 - For Your Safety, Please Use the Stairs
SCP-ES-101 - Ye Shall Not Worship False Gods
SCP-ES-102 - The Cage
SCP-ES-103 - Frustrated Musician
SCP-ES-105 - Stargazing The Other Stars
SCP-ES-107 - Partnercaller3000
SCP-ES-111 - An explorer fallen from somewhere else
SCP-ES-112 - 🤑🔫 pay 2 win 🔫🤑
SCP-ES-113 - Special Deal
SCP-ES-115 - This is the Metro of Franco's Spain
SCP-ES-116 - A Gossiper Gramophone
SCP-ES-117 - A second chance
SCP-ES-119 - The Ministry of Abnormalities of Cuba
SCP-ES-120 - This Sickness Will Not Defeat Me
SCP-ES-122 - greatGreenishGreenery v1.01
SCP-ES-123 - Aurus Trading Company
SCP-ES-125 - North Korean Orbital Bombardment System
SCP-ES-132 - The Wall; The Selective; The Thing That Kills You; We Don't Let Fools In; The Witch Burning; The Booby Trap; Stress; These Fools Don't Learn; We Have The Key; The Key; I Need Sleep; Sometimes, A Break; Sometimes, A Life; Merlín
SCP-ES-133 - The Green One always finds its way
SCP-ES-136 - Penitent Cry
SCP-ES-137 - Sadness
SCP-ES-142 - The Bones of the Saints
SCP-ES-143 - May the Light of St. George lead us to Victory
SCP-ES-145 - Funerary Licentiousness
SCP-ES-146 - Who am I?
SCP-ES-147 - Cessation of Legacy
SCP-ES-152 - The Fall of the Fools
SCP-ES-157 - Coppélia
SCP-ES-158 - And the Potatoes Took Over the Earth
SCP-ES-163 - Elephant Graveyards
SCP-ES-165 - Kaiju Sarcophagus
SCP-ES-169 - The Hentai Dream Made True
SCP-ES-173 - The last sacrifice to Vulcan
SCP-ES-178 - The best re-union you will never have.
SCP-ES-180 - It's not yours, it's ours
SCP-ES-181 - The King Who Burnt
SCP-ES-184 - Vitrified Fortresses
SCP-ES-185 - Space Swallow
SCP-ES-186 - Absolute Corruption of Power
SCP-ES-191 - Stellar Garden
SCP-ES-193 - On the 13th of April, 2013, a Train Fell From the Sky
SCP-ES-194 - That motherfucker Fidel Castro just won't stay dead!
SCP-ES-196 - Buried Dreamers
SCP-ES-199 - Institution for Dealing with Your Issues of Normalcy
SCP-ES-200 - Mind Control Ball Cactus
SCP-ES-201 - Theatrum Mundi
SCP-ES-202 - What is HANSARP?
SCP-ES-203 - Super Golden Fruit
SCP-ES-208 - Flying Pigs
SCP-ES-216 - Lutiya, Pillar of Silence
SCP-ES-220 - Burning Soul
SCP-ES-230 - EAGLE Protocol
SCP-ES-232 - Gramophone Gal (Do You Like Gramophones?)
SCP-ES-234 - Detective Marw, Private Eye
SCP-ES-245 - Autarchy of Atonement
SCP-ES-250 - First Parca: Sons of the Harvest
SCP-ES-251 - Second Parca: Tales of Misery
SCP-ES-252 - Third Grim Reaper: The Life of Death
SCP-ES-256 - At midnight
SCP-ES-260 - The Blue Eyes of Gea
SCP-ES-261 - The taste of the stars and the desolation of Juno
SCP-ES-262 - RAVEYARD
SCP-ES-264 - A Friendly Crab
SCP-ES-266 - Scavenger Jellyfish
SCP-ES-268 - Electromagnet-shrooms
SCP-ES-284 - A, last? regret
SCP-ES-288 - Who is that walking beside you?
SCP-ES-290 - Wrong Taxi
SCP-ES-296 - The Path From Which We Come From
SCP-ES-297 - 🌮🔔
SCP-ES-100-EX - Mother Nature
SCP-ES-112 Extended Testing Log
Document-ES-061-B
SCP-RU-178 - The Heroes Of Vólorovsk
Proposal by Nico, Who Has Gone A Little Crazy
SCP-ES-I don't care-J - I don't care
SCP-ES-050-h2o-J - Bears are better than crocodiles. Probably.
SCP-ES-101-J - The Hard-To-Open Container
Emily Miranda Sends Nudes

Тайский филиал

CODE NAME: DrSSS - Another World Comers
SCP-009-TH - Human Anatomy Model
SCP-043-TH - Human Ice Cream
SCP-072-TH - The Castle Guards
SCP-400-TH - The Elephant is a Blood-thirsty Animal
SCP-412-TH - The Lattice (The Hydrologic Cycle)
SCP-747-TH - The Black Box
SCP-901-TH - The Giant Head
SCP-903-TH - Very Huge Dinosaur
SCP-025-TH-J - Stop for Inspection Sign
SCP-222-TH-J - ~~The Troll Cat~~ The Genius Hacker Cat

Японский филиал

CODE NAME: solvex - Acquittal and Miniascape
CODE NAME: amamiel - Ave Maria
CODE NAME: indonootoko - Arahitogami
CODE NAME: k-cal - ~~The Balance Scales~~ The Handover Report You Want
SCP-010-JP - "Mirai PC"
SCP-017-JP - Local Rules
SCP-020-JP - Winged Human
SCP-023-JP - Shadow Railway Line
SCP-030-JP - Petroleum Devourers
SCP-043-JP - Seasoning that Makes Anything Edible
SCP-047-JP - "For the Greatest Music"
SCP-065-JP - ~~from today on i am the prime minister~~ All We Need Is Dominator
SCP-076-JP - Terror Overhead
SCP-082-JP - To the Desired Country
SCP-086-JP - Zombie Virus
SCP-088-JP - Babies Can Choose Their Moms and Dads to Be Born to
SCP-094-JP - Marine Man
SCP-095-JP - Satō Saitō
What is SCP-105-JP? I've investigated it in my own way!
SCP-115-JP - Nue
SCP-120-JP - The World's Most Valuable Jewel
SCP-132-JP - One Fish, Two Fish, Paper Fish, Silverfish
SCP-167-JP - Restaurant Seashore
SCP-181-JP - Effective Advertising
SCP-184-JP - Worn-Out Utility Pole
SCP-194-JP - Paradise Inside a Memory
SCP-199-JP - Another Audience
SCP-266-JP - A Town Without Anyone
SCP-268-JP - The Never-Ending Epic
SCP-272-JP - "Floora"
SCP-277-JP - Feigning Death Tank
SCP-333-JP - The Earthlings
SCP-359-JP - Penguin Mushroom
SCP-373-JP - Manufacturing Group
SCP-398-JP - Eternal Room 105
SCP-407-JP - A Tub
SCP-419-JP - An Alternate History of Easter Island
SCP-444-JP - █████[ACCESS UNAUTHORIZED]
SCP-475-JP - I Want to See Only Beautiful Things
SCP-496-JP - Warning: Electronic Protocol in force when viewing this document
SCP-522-JP - Airborne Baguette Concentration Measurement Station
SCP-534-JP - Get a Glass for Flea
SCP-546-JP - Sugar and Spice and All That's Nice
SCP-548-JP - Singing Rain Sounds
SCP-557-JP - Déjà Mort
SCP-558-JP - Bunch o' Chicks 'n' BIG MAMA
SCP-569-JP - Konpeight
SCP-571-JP - NIGIRI OF THE DEAD
SCP-583-JP - Darkness of the Remembrance
SCP-586-JP - Snow Globes Past the Sell-By Date
SCP-588-JP - Transdimensional Buttock Wall ~ A Karcist's Ass Sticking Out Into Our Universe ~
SCP-632-JP - Human Internal Ants
SCP-646-JP - A Retro-bender
SCP-654-JP - Matryoshka
SCP-656-JP - Human Repellant Plastic Bottles
SCP-671-JP - The Night of Electric Jellyfishes
SCP-682-JP - Tough Microbe
SCP-737-JP - Merciful Jewelry Workshop
SCP-747-JP - How To Boil Some Eggs In This Shifting Universe
SCP-751-JP - EVERYBODY,FUCK YOU
SCP-787-JP - How Those Vacuous Spines Got So Close To You
SCP-818-JP - How great-
SCP-828-JP - Launching Site
SCP-830-JP - Downfall of One Night Castle
SCP-831-JP - Lurking Summer
SCP-835-JP - ~~Xenophobia~~ Keteru Yamiko
SCP-838-JP - Urban Waves
SCP-903-JP - Mr. Kojirō feat. Joyful Dancers
SCP-905-JP - Freddie’s Special Flight Show
SCP-918-JP - That's Someone else's Lost Dreams
SCP-922-JP - Animal Relocation
SCP-926-JP - Oneiric Eternal Recurrence Of The Nightmare Beast
SCP-949-JP - Overrunning Bulldozer
SCP-981-JP - Wenkankanhoyaukamuy
SCP-1012-JP - Inversive Monotony
SCP-1020-JP - Feeding Bowl for Chucky
SCP-1044-JP - For Those Who Will Listen
SCP-1045-JP - Corrective Lenses
SCP-1078-JP - Less Guilt-Provoking Laboratory Organisms
SCP-1100-JP - CAPTCHA
SCP-1118-JP - Tokyo DisneySky
SCP-1134-JP - Explosive Nigiri Sushiblade
SCP-1139-JP - Electronic Diva
SCP-1201-JP - Lakebed Electronics Store
SCP-1242-JP - Abyssal Toilet Stall
SCP-1249-JP - People
SCP-1299-JP - They're All Alive
SCP-1300-JP - An Offering to S
SCP-1302-JP - Revolving.
SCP-1304-JP - The Day the Wild Thistle Fell
SCP-1305-JP - Infinite Monkey Would Never Abuse Drugs
SCP-1330-JP - Crackti
SCP-1332-JP - Mule at the Edge of the World
SCP-1334-JP - Towards the Beach
SCP-1357-JP - Kingfisher, Shining As Bright As Fire
SCP-1379-JP - annoying omnipotent
SCP-1405-JP - British White Silver Garden
SCP-1407-JP - Chicks could remember
SCP-1431-JP - I Really Wanna make them into Moss.min.js
SCP-1440-JP - と
SCP-1444-JP - Reenacting Proof for the Sake of Pleasure
SCP-1475-JP - Target North Carolina!
SCP-1494-JP - The Roadkill is Always Watching Over Us
SCP-1495-JP - The Bystander is Only Watching for All Time
SCP-1548-JP - You Offend My Eyes
SCP-1566-JP - When the Body Dies, the Mind Also Dies; and When the Mind Dies, the Body Is As Good As Dead
SCP-1576-JP - Hence the God Exists
SCP-1577-JP - The Cow Lay Down On The Grass Because It Was So Starving
SCP-1579-JP - A Man's Neighbor
SCP-1581-JP - Graveyard is Full of Balloons
SCP-1646-JP - Everything is in a Dream
SCP-1657-JP - Eyedrops From the 2↑↑↑↑2nd Floor
SCP-1673-JP - Moses and the Hot Springs
SCP-1677-JP - Space Jumper
SCP-1687-JP - With You, Someday/Eternally
SCP-1690-JP - Tān, or Ouroboros
SCP-1693-JP - Birth of the Prison
SCP-1709-JP - Katana of Poetic Justice
SCP-1710-JP - CHOPIN GODZILLA
SCP-1721-JP - Love-Doll Retriever
SCP-1732-JP - Toutei - Invitation
SCP-1748-JP - Someday Somewhere
SCP-1774-JP - Natural Apple
SCP-1783-JP - The Ship is Full of Rabbits
SCP-1792-JP - Guillotine Lemonade, Friendly Price 25¢
SCP-1803-JP - Perpetual Generator, or a Black Box
SCP-1810-JP - QR Bird
SCP-1828-JP - Foggy Forest
SCP-1841-JP - Don't Get Off Your Pedestal
SCP-1857-JP - Cherry Blossom of Permanence
SCP-1866-JP - A Job to Save the World
SCP-1868-JP - Freed Headless Feline Carcasses (they can't go anywhere in the first place, and the neighbors don't give them a shit)
SCP-1873-JP - Yoke of Flesh
SCP-1876-JP - Out of Mom
SCP-1934-JP - Shiba Inu on the Suspension Bridge
SCP-1936-JP - This Connection Has Been Severed by a Nightmare Collective
SCP-1944-JP - Unfortunate Flying Object
SCP-1977-JP - Death Got A Non-Aquaphobic Horse
SCP-1978-JP - Sailor Suit and Machine Gun
SCP-1988-JP - Heisei Convenience Store Myths
SCP-1995-JP - Ushi-Gozen
SCP-1998-JP - A Girl Who Changes Shape with Extreme Force and a Super Deranged YouTuber
SCP-2005-JP - Sword of Judgement, Bell of Forgiveness
SCP-2048-JP - An Ordinary Coin
SCP-2057-JP - Back to the Egg, Then It Hatches
SCP-2061-JP - Adventure Tale at Gyouseiya Department Store
SCP-2077-JP - Turing Shredder
SCP-2113-JP - And He Closed His Eyes
SCP-2152-JP - Tranquility, Anxiety, Drinking Down into the Darkness
SCP-2170-JP - Oneigal Upload
SCP-2188-JP - Light Fingers with a Ready Tongue
SCP-2200-JP - BBC
SCP-2203-JP - Reset
SCP-2211-JP - Foundation Department of Hell
SCP-2227-JP - Tell Me Stories
SCP-2233-JP - He Who Was Mourned By As Many People As Possible
SCP-2300-JP - Whether I Stay or Not, I May Never Go Anywhere
SCP-2351-JP - Virtue's Vengeance
SCP-2371-JP - Soytaurus
SCP-2403-JP - Invasive Species Throwing Dude
SCP-2422-JP - Language Kusōzu
SCP-2424-JP - Lincoln Century
SCP-2426-JP - Won't You Jump Out At Me From That Corner?
SCP-2429-JP - Pufferfish Eten
SCP-2433-JP - Wrongful Indulgence
SLOT UNALLOCATED - That Which Kills Me
SCP-2459-JP - It Must Be a Warm Place That Leads to Hell
SCP-2472-JP - Nyankoderoga
SCP-2476-JP - cat.exe (Modification Prohibited)
SCP-2493-JP - Broken Smile
SCP-2503-JP - Those Who Wait for Absolute Zero
SCP-2505-JP - Processed Quail
SCP-2507-JP - Jumpscaring Ghosts
SCP-2513-JP - At Least, Be the Foundation
SCP-2566-JP - RETURN PARADOX
SCP-2580-JP - The Great Death
SCP-2581-JP - Make Me Look Pretty☆
SCP-2601-JP - "Me, and Yayoi, and Miyuki, and…"
SCP-2613-JP - Fear Conditioner
SCP-2626-JP (SCP-262-IE) - Casadh an tSúgáinTangled Thread
SCP-2642-JP - Making "Project Arca"
SCP-2650-JP - Transfeuneral
SCP-2687-JP - Meaning of Life/Meaning of Death
SCP-2707-JP - Floral Tribute for Me
SCP-2733-JP - The Road To Hell Is Paved All Over With Good Intentions, Even Having Information Signs
SCP-2744-JP - てるてるネコちゃん
SCP-2755-JP - A Star at the Bottom of a Lake
SCP-2760-JP - Dazzling with gold
SCP-2784-JP - Someone is Talking About You Somewhere
SCP-2788-JP - Your nth Dead Grandma
SCP-2790-JP - Foundation Department of Retention
SCP-2833-JP - SKYWELLS: THE SECOND
SCP-2840-JP - The Room
SCP-2844-JP - Cognitive Dissonance
SCP-2851-JP - No Longer Red Needed
SCP-2855-JP - SKYWELLS: THE FIRST
SCP-2856-JP - My Hero
SCP-2880-JP (Unassigned Number)
SCP-2891-JP - Interstellar Retribution
SCP-2904-JP - How Many Pigs Have You Ever Murdered?
SCP-2920-JP - Strangulation Demon
SCP-2955-JP - Septette for the Dead CN-Aniki
SCP-2973-JP - The Man with the Most Powerful Abilities Ever
SCP-2975-JP - "Cuz When I'm Up Late, I Wanna Eat Somethin'"
SCP-2989-JP - The Star of My Wish Rises in the Clear Blue Sky
SCP-666-JP-J - The Ultimate Horrible Object
SCP-999-JP-J - The Tickle Master
SCP-Shrimp-JP-J - ＞ A saury ＜
SCP-K2-JP-J - Oh shit !!!
5Ç卩-譁?ｭ怜喧縺-JP-J - Untellable
SCP-014-JP-EX - I Just Wanted to See that Look on your Face

Немецкий филиал

SCP-009-DE - Cheap Gas
SCP-015-DE - Dr. Duck
SCP-017-DE - R.T.I. Grizzly A1
SCP-028-DE - Sonderkommando for the paranormal
SCP-030-DE - R.T.I. Hammer P1
SCP-031-DE - Isabelle
SCP-034-DE - Shower of dread
SCP-042-DE - Avoid Containment
SCP-045-DE - What are you searching for?
SCP-046-DE - Shuffling Corpse
SCP-051-DE - Mr. Soother
SCP-056-DE - R.T.I Sentinel
SCP-058-DE - Peaceful Zombies
SCP-066-DE - The little Spellbook
SCP-070-DE - Pink Colony
SCP-076-DE - Face-Swap App
SCP-083-DE - Badge of Physical Fitness
SCP-087-DE - Confused AI
SCP-089-DE - The Athena Project
SCP-090-DE - I‘m SCP!
SCP-091-DE - The Loving Doll
SCP-096-DE - A Cosmic Phenomenon
SCP-098-DE - Demon vs Machine
SCP-099-DE - Gasmen
SCP-100-DE - The gargoyle's misdeeds
SCP-101-DE - Eik, the Tree of Knowledge
SCP-117-DE - The News of the Day to Come
SCP-121-DE - Telepathic humanoid
SCP-122-DE - Frau Harlekina
SCP-124-DE - Don't notice me
SCP-125-DE - The Imprisoned Regent
SCP-131-DE - Real Estate Shark
SCP-136-DE - The boy who stops time.
SCP-137-DE - Ice Phoenix
SCP-140-DE - Morts volantes
SCP-148-DE - Blue Slime [Level 25]
SCP-149-DE - The Spirit of Ruin
SCP-150-DE - Die Verteidiger
SCP-173-DE - Hating Stones
SCP-177-DE - The Rungholt Shard
SCP-178-DE - Dreamlike Weather
SCP-179-DE - To the most Righteous
SCP-180-DE - A little cute Birthdaypenguin
SCP-184-DE - Arachnophilia
SCP-186-DE - The True Meaning of Christmas
SCP-187-DE - Mathilda
SCP-188-DE - B4 “Blitzgewitter”
SCP-190-DE - Thor, God of Kebab
SCP-192-DE - "Knowledge"
SCP-200-DE - Higher Mathematics
SCP-201-DE - Metal Dragon
SCP-204-DE - The Chest of Eternity
SCP-207-DE - The heart of Cupido
SCP-208-DE - St Caesarius Hospital
SCP-209-DE - The idiot box
SCP-226-DE - Knight Cuddle Steel
SCP-227-DE - Moo
SCP-234-DE - A Christmas miracle
SCP-236-DE - A cup of love
SCP-237-DE - Her heart and his soul
SCP-239-DE - USB Jird
SCP-248-DE - Omni fork
SCP-255-DE - The Perfect Mascot
SCP-257-DE - A butt ugly owl
SCP-260-DE - Ahead of her time
SCP-272-DE - Megalodon
SCP-281-DE - A pretty good hotel
SCP-292-DE - Sweet Easter
SCP-293-DE - Aliens, go home!
SCP-296-DE - In death we blossom
SCP-297-DE - Combustible Deep-Sleep
SCP-299-DE - What the Future Holds
SCP-004-DE-EX - Repulsive
SCP-015-DE-J - This is why the SCP Foundation hates Ducks and Geese
SCP-027-DE-J - The Big Bad Tap Hen
SCP-033-DE-J - Earworm
SCP-044-DE-J - This damn schnapps
SCP-(INSERTANYNUMBERHERE)-DE-J - The Trainee
The Things Dr Ore Is Not Allowed To Do At The German Branch Of The Foundation

Итальянский филиал

CODENAME: /GRAF - The Dragon Of Revelation
CODENAME: /ABAD - The Values Of The Fatherland
SCP-002-IT - The Voice of the Piave
SCP-010-IT - Parental Care
SCP-011-IT - The Zero Zone
SCP-012-IT - Waltz No. 2
SCP-013-IT - Sentient Tornado
SCP-015-IT - The Boogeyman
SCP-017-IT - Sentient USB Pendrive
SCP-018-IT - EMP Barn Owl
SCP-019-IT - E-15 Chimera
SCP-020-IT - Horse with Oratory Skills
SCP-021-IT - The Capitoline Wolf
SCP-022-IT - Legion
SCP-023-IT - Hounds of the Dictator
SCP-024-IT - Rebar ಉ
SCP-025-IT - Kangaroo Mother
SCP-029-IT - The Last Vestal
SCP-032-IT - Haruspex
SCP-035-IT - The Hammer
SCP-037-IT - Subtle Vibration
SCP-038-IT - Ocean Stones
SCP-039-IT - Cordless Telephone
SCP-041-IT - A Flat World
SCP-042-IT - The Answer
SCP-045-IT - The Hypogea of the Daunia
SCP-050-IT - The Galleass
SCP-054-IT - Microcosmos
SCP-055-IT - The Devourers
SCP-057-IT - Under the Sea
SCP-066-IT - Diabolus ex Machina
SCP-067-IT - The King of the Hill
SCP-068-IT - Kaliperia
SCP-070-IT - Forgotten Depths
SCP-071-IT - Ötzi's cloak
SCP-079-IT - Locus Amoenus
SCP-080-IT - Shattered Civilization
SCP-082-IT - The Helmet of Knowledge
SCP-100-IT - Carnem Levare
SCP-103-IT - Ciapapuer
SCP-105-IT - Anachronistic Hallucinogenic Excrements
SCP-149-IT - After the End of the Eternity
SCP-004-IT-ARC - Infinite Tuning Guitar
SCP-008-IT-ARC - The Hotel
SCP-014-IT-ARC - XXXIII (Before Rewrite)
SCP-001-IT-J - The “Dragon” Of Revelation
SCP-002-IT-J - The Doctor-Destroyer
SCP-610-IT-J - The Perfect Projectile
SCP-1900-IT-J - The Pirate Kingdom
SCP-F2Y-IT-J - The [EXPLICIT]
Italian Sites -J - The best Sites of the Italian Branch!

Украинский филиал

SCP-012-UA - The Library
SCP-035-UA - Tablet of Veles
SCP-038-UA - Alike to black holes
SCP-046-UA - Tasty flashbacks
SCP-049-UA - Apparently… God?..
SCP-054-UA - Pater noster Bandera
SCP-056-UA - Pit on the road
SCP-065-UA - Deliver Us From Evil
SCP-069-UA - Cast-iron charcoal iron
SCP-079-UA - No-Sides
SCP-081-UA - Vanka-Vstanka
SCP-095-UA - Crazy Bee
SCP-2014-UA-EX - SCP-2014-RU
SCP-692-UA-J - Connection cockup

Португальский филиал

CODINAME: Project Bulwark - by slashannemoo & Vintner
SCP-002-PT - Women's Magazine
SCP-003-PT - Silent Droplets
SCP-004-PT - The Soldier and the Bomb
SCP-006-PT - Freefalling Nightmare
SCP-008-PT - Man-Man
SCP-010-PT - Peppers
SCP-011-PT - Victoria stella
SCP-013-PT - Crazy Cyborg's Samba
SCP-014-PT - Improvised Appearances
SCP-015-PT - Electromagnetic Cannon
SCP-016-PT - The Holy Grail
SCP-018-PT - Unrecorded Man
SCP-019-PT - Porcelain Dish
SCP-021-PT - Crystal Theatre
SCP-022-PT - Lawyers = Fairies and Vice Versa
SCP-023-PT - Xeno's Paradox
SCP-024-PT - A Longtime Friend
SCP-025-PT - Portable Desert
SCP-026-PT - Sober Drunk
—————— - This Shouldn't Exist
SCP-030-PT - Cultural Heritage
SCP-031-PT - Pocket Imp
SCP-034-PT - Creator Magnifying Glass
SCP-035-PT - The Pigeon
SCP-038-PT - Floating Snake
SCP-040-PT - Ostium Theater
SCP-041-PT - A Weapon Among the Stars
SCP-042-PT - The ████ Opener
SCP-043-PT - The Player
SCP-046-PT - Read a Book, Write a Book
SCP-049-PT - <N0:.WH3RE>
SCP-050-PT - The Sack Man
SCP-055-PT - Adaptive Tactical Armour for Containment and Assault
SCP-057-PT - The Abandoned Hospital
SCP-065-PT - Hard-to-Kill Armadillo
SCP-078-PT - The Fog
SCP-079-PT - Schrödinger's Planet
SCP-088-PT - This Machine Kills Commies
SCP-089-PT - I Shall Deeply Love You
SCP-094-PT - Apamachi Identity Camouflage Device.
SCP-101-PT - Manor of Madness
SCP-106-PT - Sonic Flashlight
SCP-110-PT - A Very Convincing Story
SCP-118-PT - That Which Shares
SCP-119-PT - The Pompous Girl
SCP-122-PT - Factor XX
SCP-143-PT - Escape from the Rio-Niterói Bridge
SCP-150-PT - P███ G████´s Progressive Location Pen
SCP-166-PT - The Light of the Court
SCP-170-PT - [31/12/2025]: thank you.
SCP-172-PT - Mother-of-Gold
SCP-177-PT - Time Travelling Lottery
SCP-191-PT - Acre's UFO
SCP-195-PT - Special Gift for Naughty Workers
SCP-196-PT - Midas Gloves
SCP-199-PT - Spread the Word
SCP-033-PT-EX - Dream-Catcher
SCP-019-PT-J - The Big Ban Hammer
SCP-045-PT-J - Monsterwave
SCP-075-PT-J - Good Morning!
SCP-109-PT-J - The Foundation
SCP-005-PT-ARC - The Reason Why Dendrophobia Exists
SCP-012-PT-ARC - Socrates

Чешский филиал

SCP-017-CS - Absolute Justice
SCP-023-CS - Why can't he just leave me alone?
SCP-042-CS - Northern Devil
SCP-073-CS - The cousin of Winnie the Pooh
SCP-082-CS - Captive of a frequency
SCP-087-CS - Splendid Light
SCP-148-CS - Unfinished Business

Традиционный Китайский филиал

SCP-ZH-002 - Taiwanese Unicorn
SCP-ZH-003 - Extreme Religion
SCP-ZH-004 - Marslow’s Daughter
SCP-ZH-005 - If you haven't re-shared this article with ten friends, then…
SCP-ZH-006 - The real meaning of popcorn
SCP-ZH-037 - Tears from Hawksbill Sea Turtle
SCP-ZH-038 - The Faceless Model
SCP-ZH-041 - Dreams
SCP-ZH-048 - Sword & Sorcery and Tea & Magic Hands
SCP-ZH-060 - The Deer Road Tunnel
SCP-ZH-105 - The Unfilials
SCP-ZH-132 - The 007 Game That Kills You
SCP-ZH-178 - The Bird Mug
SCP-ZH-200 - Let's Tag
SCP-ZH-228 - Tsuipu, 1947
SCP-ZH-236 - Last Year Syndrome (Senioritis)
SCP-ZH-251 - Ruins In Third Floor
SCP-ZH-261 - Cuban Sugar
SCP-ZH-282 - The Gourmet
SCP-ZH-310 - Anomalous Protein Domain
SCP-ZH-446 - Became Bug
SCP-ZH-526 - I’m Just a Toaster
SCP-ZH-545 - I'm Not A Dinosaur
SCP-ZH-617 - The Brave One From the West
SCP-ZH-618 - Sun Pastry Lion
SCP-ZH-736 - You Can't Go Any Further
Mrs. Alicia
SCP-ZH-860 - dado's Hair/Have-fortune Drug
SCP-ZH-889 - Beyond This World
SCP-ZH-973 - As Your Hatred
SCP-ZH-2005-EX - Internet Celebrity
SCP-ZH-9288-EX - You are completely aware that you will never meet the person sitting next to you listening to your story ever again.
SCP-ZH-00l - SCP-ZH-001
SCP-ZH-60053-J - HONK

Вьетнамский филиал

SCP-002-VN - Funeral
SCP-006-VN - The Night Stars
SCP-012-VN - One Gains, What One Wishes
SCP-013-VN - Poisonous Milk
SCP-014-VN - Dream Crayons™
SCP-018-VN - The Two-Wheeled Hatred
SCP-024-VN - The Beginning of All
SCP-033-VN - Rubber Duck
SCP-036-VN - The Cube
SCP-040-VN - Those Black Words
SCP-096-VN - Where the Earth Meets the Tide
SCP-099-VN - The Waifu Heaven
SCP-100-VN-J - The True Omnipotent SCP
SCP-6789-VN-J - A Kettle-Class Loudspeaker

Структурные: публичный_черновик

версия страницы: 7, Последняя правка: 23 Авг. 2023, 15:28 (442 дня назад)

SCP Foundation

Russian Branch

Список доступных тегов