Random Fragments

Фрагмент списка для редактирования

Содержание
3000-3099
3100-3199
3200-3299
3300-3399
3400-3499
3500-3599
3600-3699
3700-3799
3800-3899
3900-3999

3000-3099

SCP-3010 - Causal-Absent Paranoia
SCP-3011 - Loose Lips Skink Ships
SCP-3012 - Smoke the Reefer, Meet the Reaper
SCP-3013 - An Expression of Mourning
SCP-3014 - Lonely Hungry Daemon
SCP-3015 - A Story Concerning Self-Doubt, Slight Disillusionment, and Frustration, As Told By the Lucky Member of a Group Whose Relatable Works Are Loved Internationally
SCP-3016 - Perpetual Motion Run Amok
SCP-3019 - The Soylent Nursery
SCP-3024 - The Doxx Ghost
SCP-3025 - Lucidity
SCP-3028 - Take On Me
SCP-3032 - Ballistic Trees
SCP-3033 - A Human Weapon
SCP-3037 - A Model City
SCP-3038 - A White Door
SCP-3039 - An Antiquated Guide
SCP-3040 - Give Her A Hand
SCP-3042 - Dog Is Love
SCP-3044 - Evolution In A Bottle
SCP-3046 - Model TH-223
SCP-3047 - To Be Drowned by A Train
SCP-3048 - Tantalus
SCP-3050 - Ogden
SCP-3051 - Interactive Time Loop
SCP-3053 - Off the Rails
SCP-3055 - Yes, And
SCP-3058 - Concavity
SCP-3059 - Infictious Self-Insert
SCP-3060 - Sleep Paralysis
SCP-3061 - Reluctant Fiend
SCP-3062 - The Lone and Level Sands Stretch Far Away
SCP-3064 - Hymn of Courage
SCP-3065 - The Man Cave
SCP-3066 - Absurdity
SCP-3067 - Interdimensional Pirate Radio Station
SCP-3068 - Halycon Light Beta
SCP-3069 - To Force the Hand of God
SCP-3070 - Highly Unusual Attempts at Solar Conquest
SCP-3071 - To Deny Sense
SCP-3072 - They're Trading Away Our Lives Out There
SCP-3075 - A Day At The Beach Is All It Takes
SCP-3076 - Avidity
SCP-3077 - Sugar Golems
SCP-3079 - 300 Tricks: Stage Magic Made Easy
SCP-3080 - The Power of Love
SCP-3082 - Neverland's Lost Boys and Girls
SCP-3084 - Seven Strangers at a Feast
SCP-3085 - Seasons Change
SCP-3087 - The Owl-Car
SCP-3088 - Law Of The Land
SCP-3089 - That Old Time Religion
SCP-3090 - This girl's gone bad on a game attack!
SCP-3091 - Temporal Funnel Trap
SCP-3092 - Gorilla Warfare
SCP-3093 - The Color Vulvide
SCP-3094 - Fall into the Gaap
SCP-3095 - Bird is the Word
SCP-3097 - A Game Of Fetch
SCP-3098 - Triviality

3100-3199

SCP-3100 - The Reliquary
SCP-3101 - Contain Me Harder
SCP-3102 - The Conflagration
SCP-3103 - Vengeful Wings
SCP-3104 - Cops Magnet
SCP-3105 - Laxity
SCP-3106 - A Flesh Removing Bog
SCP-3107 - The Well Documented Marble
SCP-3108 - The Nerfing Gun
SCP-3109 - Indeterminate Source
SCP-3110 - One Man's Trash…
SCP-3112 - InDi-Mail
SCP-3114 - Wouldn't it be Chilly?
SCP-3115 - 99.7 Cognitohazard FM
SCP-3116 - It's time to stop posting
SCP-3119 - Lord of the Dance
SCP-3120 - Help Desk
SCP-3121 - Get Out of My Head
SCP-3122 - You Have Reached Your Destination
SCP-3123 - Insult To Injury
SCP-3126 - The Immobile Muse
SCP-3127 - Nineteen Year Old Jessica Lambert And A Female Pig Of Abnormal Size, Forever
SCP-3129 - Mr. November
SCP-3132 - Crackin' the Back Knack
SCP-3134 - The Things Left Behind
SCP-3135 - Star Trek: The Next Generation: The Journey Continues!
SCP-3139 - America's Labyrinth
SCP-3140 - Botanical Warfare
SCP-3141 - Anomalous Theorem
SCP-3142 - If you can dream it, you can do it (as long as your dream is of being broke)
SCP-3144 - The Real World Is Faker Than Wrestling
SCP-3145 - Self-Insert
SCP-3146 - Money Match
SCP-3147 - Tongue Twisted
SCP-3148 - Tranquility
SCP-3149 - Monkey Business
SCP-3151 - Movie in a Bottle
SCP-3152 - The Last Love Letter
SCP-3153 - Bugging Me
SCP-3155 - We Never Sleep
SCP-3156 - Civilization Carrier Case
SCP-3157 - The Second Castle
SCP-3161 - The Plight of Poor Sir Gregor
SCP-3162 - Social Life
SCP-3163 - The Almanack
SCP-3164 - Character Test
SCP-3165 - Dog Teeth
SCP-3167 - Character Assassin (Or: The Serial Killer)
SCP-3169 - finna nut
SCP-3172 - A Field Of Unfortunate Flowers
SCP-3173 - Forest Prison
SCP-3174 - Kleiner Freund
SCP-3175 - A Wish Granted
SCP-3176 - Estimated Time Of Arrival
SCP-3178 - Through God, All Things Are Possible
SCP-3180 - No Strangers to Love
SCP-3181 - Lemme Get It Boneless
SCP-3182 - The Grocery Store
SCP-3184 - I'm sick of bugs getting stuck in my god damn bathroom light
SCP-3185 - The Public Domain Protection Service
SCP-3187 - Honu
SCP-3188 - This Man Must Die
SCP-3189 - For The Man Who Has Everything
SCP-3191 - Consciousness Emulator
SCP-3192 - When the Bell Tolls
SCP-3193 - Christmas War
SCP-3194 - Divine Presence
SCP-3196 - The Adventures of Rex Dangerly
SCP-3197 - A Trickster God for the Modern Age
SCP-3198 - Miniature Task Force

3200-3299

SCP-3202 - The Deeper End
SCP-3203 - The Swiss Bank Account
SCP-3204 - The Quantum Horse
SCP-3205 - Adventure Tourist
SCP-3206 - Who Wouldn't Want A Vomeronasal Organ?
SCP-3207 - The Think-Tank
SCP-3208 - YKHN
SCP-3209 - Boredom Butterfly
SCP-3210 - Alternative Facts
SCP-3214 - Star Quality
SCP-3215 - Delicious Anemone
SCP-3217 - Mail "H" for "Hero".
SCP-3218 - Animals in Boxes
SCP-3219 - This Sour Earth
SCP-3222 - A Very Real Pencil
SCP-3223 - Ancient Egyptian Pet Whisperer
SCP-3224 - Family Tree
SCP-3225 - Dream for Ourselves Alone
SCP-3226 - HEADBONES™!!
SCP-3227 - Dart Frog Flora
SCP-3228 - добрите стари дни
SCP-3229 - A Blessed Sea
SCP-3230 - Intergalactic Isolation
SCP-3233 - Tenrec Goddess Reborn
SCP-3234 - Pure Grey Static
SCP-3235 - The Baba-disease
SCP-3236 - All Those Fucking Ideas
SCP-3239 - When Death Comes Calling
SCP-3240 - The Bones Of What You Believe
SCP-3241 - The SS Sommerfeld
SCP-3242 - Operative Disease Mouse
SCP-3243 - The Green Warden
SCP-3244 - Mountain Dew: Code Red
SCP-3245 - Mr. Playing Games Is Bad For Your Health
SCP-3246 - A Nice Old Lady
SCP-3247 - A Magic Mime and his Mighty Morphin' Method Acting Spider Kids
SCP-3248 - Who Shot Sulley?
SCP-3249 - Me, Us, Them, Them
SCP-3250 - Jesus Fried Chicken
SCP-3251 - The Coconut Crab Captain
SCP-3252 - The Permian-Triassic Extinction Event
SCP-3253 - A Prison of Ink and Flesh
SCP-3255 - A Light Shining Through The Holes Inside Your Eyelids
SCP-3256 - Web of Murder
SCP-3257 - A Priest in a Suitcase at Timbuktu
SCP-3258 - God Killers
SCP-3259 - Verminous Ark
SCP-3261 - The Dragon's Tongue
SCP-3262 - Fire of Unknown Origin
SCP-3263 - Mr. Headgeworth's School for the Magically Gifted
SCP-3264 - Causeless Effect
SCP-3265 - It's Good
SCP-3266 - Time Loop in the Ardennes Forest
SCP-3267 - Memories Bound in Paper
SCP-3268 - Digital Predator
SCP-3269 - Pop Culture
SCP-3273 - Self-Performed Brain Editing Manual
SCP-3274 - Nowhere Else To Run
SCP-3275 - Excuse me, this is the wrong pizza.
SCP-3276 - Young Successful Independent Self-Employed CEOs
SCP-3277 - Speak Softly And Carry A Big Stick
SCP-3279 - The Afterimage
SCP-3281 - [REDACTED BY AARS538]
SCP-3282 - The Worm of Your Dreams
SCP-3283 - The biggest back yard in Boise
SCP-3284 - Uncontainable
SCP-3285 - creative comas
SCP-3286 - Sea Legs
SCP-3288 - The Aristocrats
SCP-3289 - Smile
SCP-3291 - Flowers of Solomon
SCP-3292 - The Land Before Time, For All of Time
SCP-3295 - Thank You For Smoking
SCP-3296 - The Drifter
SCP-3297 - Gramma Always Remembers.

3300-3399

SCP-3305 - The Father, The Son, and The Holy Toast
SCP-3307 - Cornucopi-ass
SCP-3308 - Crooked Excavator
SCP-3309 - Where We Go When We Fade, Fade Away
SCP-3310 - The Old Man of the Lake
SCP-3311 - All the Little Chairs
SCP-3313 - Poor Richard
SCP-3315 - ｐｅｒｓｅｖｅｒａｎｃｅ
SCP-3317 - Libre la Livres
SCP-3320 - Ethical Relativity
SCP-3321 - Edge of the Universe
SCP-3322 - Sister Cities
SCP-3323 - R35urr3c710n
SCP-3324 - Getting kidney stones in the past is more useful than you'd think
SCP-3326 - The Threads of Fate
SCP-3327 - Soviet Bunker(s)
SCP-3328 - Where Dead Men Grow
SCP-3329 - A Sucker Born Every Minute
SCP-3330 - Études for the Universe
SCP-3331 - With Apologies To John Cena
SCP-3334 - Literally a Billion Memes
SCP-3335 - The Hole in My Head Where My Mind Used to Be
SCP-3336 - God Bless You
SCP-3337 - Death Of The Artist
SCP-3339 - Randall the Clown's Wacky Broadway Theatre
SCP-3341 - Arabian Nasnas a.k.a. Somali Hungruf
SCP-3342 - The Blackfoot Potato Transplants
SCP-3343 - Beelzebub
SCP-3345 - Crime Novel
SCP-3346 - Worry Hat
SCP-3347 - They Grow Up So Fast
SCP-3348 - Lost Dictionary
SCP-3349 - Printing EKG
SCP-3350 - Shape Up!
SCP-3352 - Bethlehem Steel
SCP-3353 - Secrets for Sweets
SCP-3354 - Killmotor Hill
SCP-3355 - St. Nick
SCP-3356 - The Unity of the Prokaryote
SCP-3357 - Practice Makes Perfect
SCP-3358 - ~~Anomaly Apartments~~ Site-316
SCP-3359 - The Dry Guy
SCP-3360 - Proletariart, by San Francisco Jones
SCP-3362 - A Forced Self-Insert
SCP-3363 - The Citizen Kane of Lightning-induced Reality TV
SCP-3364 - Time Static
SCP-3365 - Lunar Module 16 ‘Phoenix’
SCP-3366 - Man in Hole
SCP-3367 - Prayers from Children, Eternally Answered
SCP-3368 - Bees on the Brain
SCP-3369 - A Living Joke
SCP-3370 - Dead Air
SCP-3371 - Beautiful Inside My Head Forever
SCP-3372 - A Betrayer's Retribution and Quite the Earful
SCP-3373 - Our Whole Universe was in a Hot Dense State
SCP-3374 - Aquaria Phenomena
SCP-3375 - Traveling Garden Eels
SCP-3376 - The Dreaming Stone
SCP-3378 - Info Drones
SCP-3379 - D-11424 and the Arctic Meat Hole of Infinite Wonders
SCP-3380 - Science, Technology, Engineering, Divinity
SCP-3381 - Dream Studios
SCP-3385 - The Last Voyage of the Far Horizon.
SCP-3386 - Night Owls
SCP-3387 - A Small World After All
SCP-3389 - The Lake That Burns You
SCP-3390 - A French Tank
SCP-3391 - An Artificial God
SCP-3392 - Euclid's Blackboard
SCP-3394 - Brain Scientist
SCP-3396 - The Empyrean Parasite
SCP-3397 - Fortes Fortuna Iuvat!
SCP-3398 - Hilbert's Grand Elevator

3400-3499

SCP-3401 - Anyone Fancy A Cup Of Jade? Or maybe some Earl, or Jasmine?
SCP-3402 - Rural Exodus Event
SCP-3403 - Summer Dogs
SCP-3404 - Down With the Sickness
SCP-3407 - ¢10 Per Ticket
SCP-3409 - The Chocolate Factory
SCP-3410 - "It's just fucking golf!"
SCP-3412 - Life in a Peaceful New World
SCP-3413 - Irwin Shrugged
SCP-3414 - Beware of Toilet Snake
SCP-3415 - Employee of The Month, Every Month
SCP-3416 - The Great Anoati!
SCP-3417 - The Preachers of Globular Cluster Terzan 2
SCP-3418 - Devourer of Flames
SCP-3419 - Humants
SCP-3420 - Too Many Ghosts
SCP-3421 - Cell Phone Trees
SCP-3423 - Inspirational Window
SCP-3424 - Esto No Es Un Limón.
SCP-3425 - The Joy of Creation
SCP-3427 - Anatomical Civilization
SCP-3428 - Buried Hummingbirds
SCP-3429 - Just The Way It Is Now
SCP-3430 - Baby Don’t Hurt Me…
SCP-3431 - Refuse Koala
SCP-3433 - I am a Deeply Superficial Person
SCP-3435 - Analysis-Defying Dinosaur Painting
SCP-3436 - ABE
SCP-3438 - Recursive Romance
SCP-3439 - A Postcard
SCP-3440 - The Marvellously Macabre Mechanical Marionette Matinee
SCP-3442 - Innovative and Synergistic Customer-Directed Actualization
SCP-3444 - She Took The Midnight Train Going Anywhere…
SCP-3445 - Grave Insights
SCP-3446 - The Waders
SCP-3449 - The Things Left Unsaid
SCP-3450 - OC DO NOT STEAL
SCP-3451 - The Shade Closet
SCP-3452 - Durendal
SCP-3453 - The Juice is Loose
SCP-3457 - The Rite of Solomon
SCP-3458 - Bad Sectors
SCP-3459 - Phobia Plague
SCP-3460 - I'm Going to Change Your Life
SCP-3461 - When The Saints Go Marching In
SCP-3462 - Lights, Camera, REDACTION
SCP-3463 - Flawless Objective Perception
SCP-3464 - Olive Garden regularly communes with DEMONIC ENTITIES to summon their SATANIC sempiternal garlic bread
SCP-3465 - Better Safe Than Sorry
SCP-3466 - Only Birdbrains Live the American Dream
SCP-3467 - Anomoaly
SCP-3468 - Only YOU can prevent forest fires
SCP-3469 - Nice Cream
SCP-3471 - Paint Under the Bridge
SCP-3472 - Mother Loves her Baby
SCP-3473 - The Son of the Sun
SCP-3474 - Grief Ignited
SCP-3475 - Our Shifting Foundations
SCP-3476 - A Place to Sever Stranded Heartstrings // Alex's Fountain
SCP-3478 - A human-shaped hole to the meat dimension
SCP-3479 - Proof We Are All As Angels
SCP-3480 - Olympus Mons
SCP-3481 - Glorious Sounds
SCP-3482 - fine mayor posters campaign by dado
SCP-3485 - Omega Messier
SCP-3486 - Baby Mine
SCP-3488 - Mimir, The Root Of All Knowledge
SCP-3493 - The Great SCP Foundation Collaboration
SCP-3495 - St. Brendan's Howler Monkey
SCP-3496 - Can We Bee Friends?
SCP-3497 - Backfiring Birds
SCP-3498 - Monachopsis
SCP-3499 - Please Stand By

3500-3599

SCP-3500 - Instructions Unclear, Got Dick Stuck in Canon 🍆➡️📕
SCP-3501 - The Storyteller of Isfahan
SCP-3503 - Panic is Pure, Trauma is True, Suffering is Sweet, and Death's a Delight
SCP-3504 - "And how will we know you are one of us?"
SCP-3506 - The Reading of the Will
SCP-3507 - Father, This Day I Bring You True Glory
SCP-3508 - "Cute and soft! Kill them off!"
SCP-3509 - The Test Chamber
SCP-3510 - Not Another New World Order!
SCP-3511 - Reach Out And Touch
SCP-3514 - The Moment of the Mahdi and the Moment of the Mortal
SCP-3517 - A Hideous Mountain
SCP-3518 - Arctic Shrimp
SCP-3520 - Fourteen Orangutans
SCP-3522 - Black Body
SCP-3523 - The Quarry
SCP-3524 - You Cannot Contain Us
SCP-3525 - A 5-Star Lyft Driver
SCP-3526 - Ave, True to Caesar
SCP-3529 - snake = snek = cute ^~^
SCP-3530 - Shooting Star School
SCP-3532 - Merch Link in Bio
SCP-3533 - Metaphysiclean!
SCP-3534 - Doomsyesterday
SCP-3535 - Casus Lignum
SCP-3538 - THE GREATEST CARABINER EVER
SCP-3539 - So That Others May Live
SCP-3540 - Don't Queer the Reaper
SCP-3541 - Twice as Bright
SCP-3542 - "Fear Not, Citizen!"
SCP-3543 - One, Two, Four
SCP-3544 - Home is Where the Heart Was
SCP-3545 - The Places You'll Never Go
SCP-3547 - A Dream of Our Beloved
SCP-3548 - We exist, but only in your mind
SCP-3549 - Sweet Medieval Bitcoin
SCP-3550 - Cancer of Passion
SCP-3551 - Dr. Wondertainment's Inflatable Invasion
SCP-3553 - They All Go Into the Dark
SCP-3554 - No. 4 Borscht Canning Factory
SCP-3555 - Attempted Suicide
SCP-3557 - CK or OK?
SCP-3559 - Best Thing Since
SCP-3563 - Lemonabe, 25¢!
SCP-3564 - The Immortal Bard, Act Ⅱ: Return of Shakespeare
SCP-3566 - Not Even That Funny
SCP-3567 - Chrono-Wrap
SCP-3568 - Shapes
SCP-3569 - Buuny Butler
EE-3570 - Umbral Ultimatum
SCP-3571 - OLLIE'S OBSTACLE COURSE OF OBVIOUS OBLITERATION!
SCP-3572 - Sand Cave
SCP-3574 - Lambs to the Slaughter
SCP-3575 - It's a Small Town
SCP-3576 - Think But This And All Is Mended
SCP-3577 - Pack To The Future
SCP-3578 - A Mother's Love
SCP-3579 - Insta-Gator
SCP-3580 - The Devotion Locket
SCP-3581 - Corneliu
SCP-3582 - The Multiverse is Having a Seizure
SCP-3583 - Hellbus
SCP-3584 - Mechanical(?) Dandelion Garden
SCP-3585 - Wondertainment's Murder Mystery Mates
SCP-3588 - Cheers
SCP-3590 - A Dirge for the Silent
SCP-3591 - The Fallen Giant
SCP-3592 - Kindertransport
SCP-3593 - Scooby Snacker
SCP-3594 - Genesis Ulcer
SCP-3595 - Einheit
SCP-3596 - Super Justice Containment Action Squadron
SCP-3598 - Bishop's Glen Memorial Park
SCP-3599 - A Hard Day at Work

3600-3699

SCP-3600 - Documenting Doomsday
SCP-3601 - A Cautionary Tale
SCP-3602 - The Monkey King's Legacy
SCP-3604 - Craydaddy
SCP-3605 - The blue is so beautiful
SCP-3606 - Praise You
SCP-3607 - Residence Evil
SCP-3608 - PTSD: Post-Traumatic Stress Dimension
SCP-3609 - Hati Hróðvitnisson
SCP-3611 - The Yamauchi Deck
SCP-3612 - The Mainlist is Out of Order; Please Try Again
SCP-3613 - Things You People Wouldn't Believe
SCP-3614 - Your Reality
SCP-3615 - Depressed Divine Demon of Diptera & Diarrhea
SCP-3616 - Writer's Block
SCP-3617 - The Parasites of Normal
SCP-3618 - Supply and Demand
SCP-3619 - You Spin Me Right Round, Baby, Right Round
SCP-3620 - Data Expunged the Chicken
SCP-3621 - Best Intentions
SCP-3622 - Agile, Handle with Care
SCP-3623 - She was my muse
SCP-3624 - Crazy Chimera Lady
SCP-3625 - The Great American Meme Machine
SCP-3627 - Dreamy Jasters
SCP-3628 - Better Not to Know
SCP-3629 - Spinder
SCP-3630 - Reverse Locked Room Mystery
SCP-3631 - A Man and his Monster
SCP-3632 - Nibirdu
SCP-3634 - In Vino Veritas
SCP-3635 - The Forgotten Archive
SCP-3636 - World's Greatest Jukebox
SCP-3638 - You can't be serious!
SCP-3639 - What-A-Boots
SCP-3641 - Remember ~~Apollo-99~~ Nased
SCP-3642 - T(r)opical Cream
SCP-3643 - Part 1: ANOMALY IS THE MOST DANGEROUS ANIMAL
SCP-3644 - Slot reserved, please do not fill
SCP-3645 - Star Child
SCP-3646 - Phantom Mosquitos
SCP-3647 - Quousque Tandem?
SCP-3648 - Buga and Buninka
SCP-3650 - Travel Bug
SCP-3651 - Chalk Children
SCP-3652 - Inverting Box
SCP-3653 - A Calendar with Extra Days
SCP-3654 - WarTime
SCP-3655 - The Last Resort
SCP-3656 - Governments in Exile
SCP-3657 - Posthumous Hero
SCP-3658 - The Time Walker
SCP-3659 - Rubbery Triceratops Gauntlet
SCP-3660 - The Zoo Zipper
SCP-3661 - A Toy Story
SCP-3662 - The Doomsday Clock
SCP-3665 - Instant Demon, Just Add Blood!
SCP-3666 - Repairing the Mask
SCP-3667 - All's Well that Ends Hell
SCP-3668 - Provenance
SCP-3669 - A Mathematics Self Help Book
SCP-3672 - Why are there so many songs about rainbows?
SCP-3673 - But when the door is closed…
SCP-3674 - The Loss of Sector H
SCP-3675 - The Void Called
SCP-3676 - The Multiversal Megapede
SCP-3677 - Paradix High School: Paradise for the Paranormal
SCP-3678 - "It's Not That Anomalous."
SCP-3679 - Make a Geas, Foundation
SCP-3680 - The White Guys
SCP-3681 - 5 - 0
SCP-3682 - Parousia
SCP-3683 - Dire Pigeons
SCP-3684 - Pump You Full Of Lead
SCP-3685 - The Fractured Pile
SCP-3686 - Evan Deserves to be Remembered
SCP-3687 - Anti-Entropy Doorknobs
SCP-3690 - Abdominal Pains
SCP-3691 - Medium Rare
SCP-3692 - the notebook
SCP-3694 - America's Diner Is Always Open
SCP-3697 - "Let Me Redirect You Right Now"
SCP-3698 - Fresh Pine
SCP-3699 - Memoirs of a Shingle Beach

3700-3799

SCP-3701 - All the Time in the World
SCP-3703 - From Death, We Contain
SCP-3704 - Requiem
SCP-3705 - The Gardener's Shadow
SCP-3706 - 50,000 Krakens Under the Sea
SCP-3709 - Intended Purpose
SCP-3710 - Elon MUSH!
SCP-3711 - Suffering On The Rising Tide
SCP-3712 - Grandma Knows Best
SCP-3713 - All the World’s a Stage
SCP-3714 - Jiangshi's Ring
SCP-3715 - Not So Subtlє Teα
SCP-3716 - Boned Beyond Belief
SCP-3718 - An Environmental Cat-astrophe
SCP-3719 - Your Friendly Neighbourhood Lawnmower
SCP-3720 - Smiting on a Budget
SCP-3721 - Obsolete Weapons System
SCP-3722 - The City That Was Half the World
SCP-3723 - The Orca-stra
SCP-3724 - Guard Puppies
SCP-3725 - Ironically, I don't have a Good Idea for a Title
SCP-3726 - AnthropomorFic
SCP-3727 - Syringe Man
SCP-3728 - STOP. HAMMERTIME
SCP-3729 - The Best Day of Your Life
SCP-3731 - Normality Will Be Protected
SCP-3734 - Muddy Morphing Power Worms!
SCP-3735 - ForbiddeN SouNd
SCP-3736 - Talk It!
SCP-3738 - Casting Lots
SCP-3739 - Mind-Milk™ by Moosphere, Inc.
SCP-3741 - The World Is Your Oyster
SCP-3742 - A "Live" Album
SCP-3743 - Euboea, Son of Briareos
SCP-3744 - Dungeons And D-Class Personnel
SCP-3745 - As the Heart Breaks, so do the Heavens
SCP-3747 - Death by Vacuum
SCP-3748 - Bowl of Flies
SCP-3750 - A White Fish
SCP-3751 - Skip's Gambit
SCP-3752 - Cold From Within
SCP-3753 - TEA-K.O.
SCP-3754 - Pocket Pet Collector Plus!
SCP-3755 - Guess How Many
SCP-3756 - In Space, No One Can Hear Yee-haw!
SCP-3757 - Cocoon Park
SCP-3758 - The Last Dodo
SCP-3761 - The War of the Squirrels
SCP-3762 - Shelter from the Storm
SCP-3763 - A Piece of Him is Still Around
SCP-3766 - Reverse Cargo Cult
SCP-3767 - Additional Baggage Fee
SCP-3768 - Three Moons Public Radio
SCP-3769 - Evolutionary Rescission Device
SCP-3770 - One Thousand Footsteps Towards The Promised Land
SCP-3771 - Americans Be Eating Cheesed Burger
SCP-3772 - 😂 WHO DID THIS 😂
SCP-3773 - 9,000 Lives
SCP-3774 - My Heart DEETs Faster For You
SCP-3776 - Camp Nimrod
SCP-3778 - We Are Possum. We Are Legion.
SCP-3779 - A Greenhouse: Or, How D-80801 Learned To Give In And Embrace Nature
SCP-3781 - OK ペインター!
SCP-3782 - Through Roosevelt's Glasses
SCP-3783 - Baba Yaga's Cottage
SCP-3784 - High Octane Nightmare Fuel
SCP-3785 - Jasper's Hill
SCP-3786 - Chubby Dog
SCP-3787 - The Horse Meme
SCP-3791 - An Entirely Standard and Uneventful Anomaly
SCP-3792 - Up In Smoke
SCP-3793 - Spectral Punk Drive-By
SCP-3798 - There Are Flowers There

3800-3899

SCP-3800 - Many Grandparents Ago
SCP-3801 - Based on a True Story
SCP-3803 - Custom-Made Business Cards, On the Go!
SCP-3804 - Communiqués from the Apocalypse
SCP-3805 - The Birth Of The World
SCP-3807 - A Real Bad Hombre
SCP-3809 - Love in the Time of Algorithms
SCP-3810 - [UNTITLED]
SCP-3811 - A Therapist Needs A Therapist
SCP-3814 - Tag! You're it!
SCP-3816 - Blue Light
SCP-3818 - Two Favours One
SCP-3819 - Box of Desire
SCP-3820 - Sitting and Caring for Pets
SCP-3821 - Stuck In the Mailroom
SCP-3822 - K-PARTY
SCP-3823 - Put On Your Red Shoes
SCP-3825 - So it Goes
SCP-3826 - The Definition of Technophobia
SCP-3828 - A Powerful Seal
SCP-3829 - Metastasis
SCP-3831 - Can't Call Out
SCP-3832 - Surprise Pillow Fight
SCP-3834 - Fossil Records
SCP-3835 - Better inWeedients, Better Pizza, Papa John's
SCP-3836 - Grease Monkey And The Search For FAST
SCP-3837 - Corn Goblin
SCP-3838 - Nomads of the 4th-Dimensional Steppe
SCP-3839 - Liposlugtion: 2 Fat 2 Furious
SCP-3843 - Sam
SCP-3845 - Buddy
SCP-3846 - Walden Pond Scum
SCP-3848 - History Exists for the Memorable
SCP-3851 - You May Not Be Able To Drown Your Demons, But The Demons Can Drown Your Screams
SCP-3852 - Small Town Justice
SCP-3853 - Imperium
SCP-3854 - Belly of the Playwright
SCP-3857 - Call of the Tropic
SCP-3858 - Hugbox
SCP-3861 - Self-Reflection
SCP-3864 - I've Been Framed!
SCP-3865 - You Reap What You Sow
SCP-3868 - Constitution Saving Throw
SCP-3869 - High Quality Ripoff
SCP-3870 - The Ice-Cream Vigilante
SCP-3871 - Dr. Wondertainment's Allegorical Anomaly-Annihilating Assault Automaton
SCP-3872 - Consult an Alchemist
SCP-3873 - Unbearable Treatment
SCP-3875 - Spyders
SCP-3876 - Tussie Mussie
SCP-3877 - MIЯЯOЯ BÄR
SCP-3878 - Words Will Never Hurt Me
SCP-3879 - Musical Jolly Ape™ by Dr. Wondertainment
SCP-3880 - ILLEST RAIN SOUNDS ∞ Hours No Looping - White Noise, Nature/Healing/Ambient, Meditation/Insomnia/Study ASMR [ORIGINAL]
SCP-3884 - Gunmetal Gary Puts the Peddle to the Metal
SCP-3885 - The High-Octane Full-Throttle Adventures of the Exploding Zombie Gearheads
SCP-3886 - The Necromancer’s Saddle
SCP-3887 - Monster under the bed
SCP-3889 - The Greatest Fisherman Who Ever Lived
SCP-3891 - Paradise Lost and Found
SCP-3893 - I'm Going to Have a Motherfucking Meltdown
SCP-3894 - Our Sorrow
SCP-3895 - Our Unrest
SCP-3896 - We'll Never Stop Eating Big Gordo
SCP-3897 - Mother's Eye Is Upon You
SCP-3898 - The Burden

3900-3999

SCP-3906 - Нечестивый балютовый парад
SCP-3909 - Wu Tang Clan Ain't Nuthing ta Fuck To
SCP-3910 - A Comedy
SCP-3912 - Final Memories Through The Lens
SCP-3914 - Necrocapitalism
SCP-3915 - Gay Trashman
SCP-3916 - Hungry Locusts
SCP-3917 - Beetles in a Jar
SCP-3918 - To Starve Her Highness
SCP-3919 - In Memoriam
SCP-3921 - Greco-Roman Atmospheric Reconstruction
SCP-3923 - Negotium Ficus
SCP-3924 - Silent Honour Ark
SCP-3925 - It's All Papers and Forms
SCP-3926 - Saturday Evenings with your host, Tyal'k'nec!
SCP-3927 - The Fancy Mouse
SCP-3928 - Eliphalet Remington Can Kiss My Ass
SCP-3931 - The End of Days
SCP-3935 - This Thing a Quiet Madness Made
SCP-3938 - Dr. Wondertainment's Take-You-Anywhere Machine
SCP-3939 - [NUMBER RESERVED; AWAITING RESEARCHER]
SCP-3941 - The Major Occultation
SCP-3943 - Taco Man
SCP-3944 - Memory Is Fleeting
SCP-3945 - Big Huge Nightmare Panther
SCP-3946 - Amphitrite's Curse, Scylla's Wrath
SCP-3948 - The Man in the Mirror
SCP-3950 - FULL THROTTLE AXOLOTL
SCP-3951 - Doggone It
SCP-3953 - Costa Rica… IN SPACE
SCP-3954 - Scarecrow's Secrets
SCP-3956 - The Mealworm Song
SCP-3957 - The Eternal Soviet Prison
SCP-3958 - Little Brother
SCP-3959 - The End of All Knowledge
SCP-3962 - Agasesdi's Gift
SCP-3963 - I Contain Multitudes
SCP-3964 - Suicide Staircase
SCP-3965 - Zhulong
SCP-3967 - All Watched Over By A Machine Of Loving Grace
SCP-3968 - Immoral Minefield
SCP-3969 - Hofmann's Nightmare
SCP-3970 - i want to contain too
SCP-3971 - Utility Closet SB3-117a
SCP-3972 - "Ken Burns Presents: SCP-3972"
SCP-3973 - Would you like to re-roll?
SCP-3974 - Such Sweet Sorrow
SCP-3975 - Save the Oreos
SCP-3977 - Hawaiian Punch
SCP-3978 - The World Is Going Away
SCP-3981 - [UNTITLED UFO]
SCP-3982 - The Devourer of Filth Would Like to Be Friends With You
SCP-3983 - To Petition the Dead
SCP-3985 - Focus of a Regulatory Dispute
SCP-3986 - The Observatory of Genghis Khan
SCP-3987 - Purifying Exclamation
SCP-3988 - Napoleon Bonyparts, Superstar Skeleton
SCP-3989 - The Bone Orchard
SCP-3990 - Deer in the Headroom
SCP-3991 - "Lewis Island"
SCP-3992 - Wondertainment Whacky Halloween Fun Masks!
SCP-3993 - Smart WIFI
SCP-3994 - Normal Human People
SCP-3996 - The Tangential Frontier
SCP-3997 - In My End Is My Beginning

Этот файл и все связанные с ним документы доступны к просмотру только Отделу меметики. Если Вы можете прочесть это, значит Вы прошли Фазу III противомеметического обучения. Если Вы не уполномочены, но все-таки способны видеть это, значит Вы были заражены летальным меметическим агентом со средним временем наступления летального исхода равным тридцати семи минутам: немедленно доложите своему руководителю АПАИБ.

Объект №: SCP-2111

Класс объекта: Безопасный

Особые условия содержания: Доступ к данным SCP-2111 разрешен персоналу с уровнем допуска 3/2111/ПУРПУРНЫЙ ТАЛИСМАН в совокупности с действующим сертификатом Фазы III противомеметического комплекта. Доступ к данным или их просмотр должны осуществляться только через интерфейс ПУРПУРНОГО ТАЛИСМАНА. Неуполномоченные сотрудники, осуществляющие доступ к файлам, должны быть задержаны, обработаны от летальных когнитивных угроз и меметического содержимого и либо подвержены воздействию амнезиаков, либо устранены по усмотрению АПАИБ.

Этот файл должен быть защищен меметическим агентом, вызывающим отвращение/отсутствие интереса ОХОТА НА СНАРКА в дополнение к стандартным мерам сетевой безопасности.

Описание: SCP-2111 является алгоритмом, способным генерировать бесконечное число ранее неизвестных летальных когнитивных угроз. Алгоритм был получен Фондом в результате анализа множественных несвязанных аномалий с когнитивными угрозами и адаптирован для создания и поддержки летального когнитивного вооружения, используемого для информационной и физической защиты, а так же меметической обертки векторов модификации поведения. ПУРПУРНЫЙ ТАЛИСМАН это инструмент, основанный на программном обеспечении, который преобразует сырой материал, генерируемый SCP-2111, в медиа для военных целей. ПУРПУРНЫЙ ТАЛИСМАН способен генерировать непосредственно визуальные или аудиальные когнитивные угрозы, а также внедрять опасный материал в меметические носители. SCP-2111 функционирует на основе аномальных средств. На данный момент существует теория, согласно которой у него есть доступ к математическим моделям, которые при транслировании в неврологические системы создают деструктивные циклы выполнения.

Фрагмент списка для редактирования

Содержание
Корейский филиал
Китайский филиал
Французский филиал
Польский филиал
Испанский филиал
Тайский филиал
Японский филиал
Немецкий филиал
Итальянский филиал
Украинский филиал
Португальский филиал
Чешский филиал
Традиционный Китайский филиал
Вьетнамский филиал

Корейский филиал

Codename: scka - Defense mechanism
Codename: L.H. Sein - By people
SCP-002-KO - Xianess' fountain
SCP-003-KO - Farmhouse
SCP-004-KO - Eraser Phenomenon
SCP-005-KO - Mush-Room
SCP-006-KO - Killer Bed
SCP-010-KO - Honest Scam Calls
SCP-011-KO - The Sleeping Giant
SCP-014-KO - Ask Anything
SCP-021-KO - The sage's book
SCP-022-KO - The magnifying glass
SCP-033-KO - Print Foundation Documents With Caution
SCP-034-KO - Wolf Flower
SCP-048-KO - Science Club
SCP-049-KO - The Black Parade
SCP-050-KO - About SCP-050-KO
SCP-056-KO - ［ WARNING: DO NOT READ THIS PAGE! ］
SCP-064-KO - Seoul Cinematic Production
SCP-072-KO - Absolute Taste
SCP-077-KO - The Bermuda Triangle Underwear
SCP-079-KO - Containment-longing Shuttles
SCP-086-KO - Knives for Vegans
SCP-111-KO - A Small Error
SCP-112-KO - "Dog" Soju
SCP-113-KO - Eternal Thursday
SCP-114-KO - LED Fen Fire Flies
SCP-115-KO - "Meaningless" Regular Polyhedron
SCP-118-KO - The Savior of All
SCP-132-KO - Bawling Bamboo
SCP-137-KO - The Bad Land
SCP-149-KO - CC BY-NC-ND
SCP-153-KO - Read me before read below
SCP-154-KO - Read me before read above
SCP-157-KO - No time to go to the toilet
SCP-159-KO - Peach Blossom Land
SCP-168-KO - Stir-fry?
SCP-169-KO - The Volition Wins The Day
SCP-171-KO - Forgotten Music
SCP-185-KO - Visual Novel
SCP-188-KO - Heart of the Earth
SCP-189-KO - Dark alleyway
SCP-212-KO - Rusty Spade
SCP-217-KO - USS Enterprise
SCP-222-KO - A Train in Flames
SCP-229-KO - Quadrennial
SCP-234-KO - Doing Dootie Duty
SCP-268-KO - STRUCTURE ERROR
SCP-299-KO - A Murder of Crows
SCP-310-KO - Foods From That Far Place
SCP-321-KO - Fade-in Virus
SCP-326-KO - Natural reality fixation
SCP-345-KO - The Space Hero
SCP-380-KO - Now the test begins.
SCP-412-KO - [DATA NOT EXPUNGED]
SCP-416-KO - There is an instrument buried under the oak tree.
SCP-432-KO - The Child Gifted With Immortality
SCP-444-KO - Avici
SCP-499-KO - The real "BGM"
SCP-500-KO - The only cure
SCP-503-KO - Normalcy Classification System
SCP-505-KO - The Schoolbag
SCP-521-KO - What is Seeing?
SCP-545-KO - The Non-Flying Dutchman
SCP-602-KO - I want to be myself for once
SCP-621-KO - I will live in ██
SCP-650-KO - The Duty to Stop All Sin and Unhappiness On This World
SCP-689-KO - Fangi
SCP-702-KO - Grownups Don't Know
SCP-709-KO - Dismembered Eternity
SCP-713-KO - Gods of the Flying House
SCP-750-KO - Revenant Soldier
SCP-755-KO - Learn all the technology and knowledge you want; there are Other Important Things
SCP-774-KO - Planet Indra
SCP-797-KO - Skyfall
SCP-809-KO - Along the thorny vines
SCP-817-KO - Flame of Love
SCP-819-KO - Open the Curtains, Lights on
SCP-824-KO - 22×6×10²³ drops of water
SCP-825-KO - Sokcho Tongkeun Mulhoe Restaurant
SCP-826-KO - Homo Sapiens
SCP-827-KO - It's Beginning to Smell a Lot Like Christmas Everywhere I Go
SCP-828-KO - A Door Locked from the Inside
SCP-829-KO - MAD man
SCP-830-KO - 's slippers
SCP-841-KO - Supervisor: Antimeme Expert Lee Hanseok
SCP-876-KO - Head Siren
SCP-877-KO - B████d B████s
SCP-890-KO - Here be We, the Consequence of Your Actions
SCP-897-KO - [ASMR] Dentistry / Teeth Extraction Relaxing Sound
SCP-903-KO - Not Steroids!
SCP-916-KO - Perfectly Replaces the Biological Patriarch
SCP-923-KO - The Anti-Disney Department
SCP-953-KO - Pretending Humanoid
SCP-973-KO - Man With Gun
SCP-980-KO - Cloudy with a Chance of People
SCP-997-KO - The Edge of Esotery
SCP-516-KO-EX - [DATA REDUCED]
SCP-7891-KO-EX - Amnestic Mushroom
SCP-001-EX-KO-J - A Bad Boy
SCP-1004-KO-J - Girls' Magic Wand
SCP-none-KO-J - It's an annoying clothes hanger!

Китайский филиал

CODE NAME: Darkequation - Bamboo Scroll
CODE NAME: Anglia - Dragon Vein
CODE NAME: Veleafer - 演绎部
CODE NAME: Re_spectators - Substitution Reaction
SCP-CN-009 - Question, Solve, Answer
SCP-CN-010 - Aye-aye
SCP-CN-026 - No Longer be Alone
SCP-CN-048 - A Failed Attempt
SCP-CN-066 - OMG! What the Foundation Has Failed to Do for 20 Years Was Done by SCP-CN-066 in Just 4 Seconds…
SCP-CN-096 - "Stop" "Door"
SCP-CN-111 - The Solitary Venerable One
SCP-CN-114 - Pine of Awakening Smoke
SCP-CN-121 - The Badge of Dr. Sun Yat-sen
SCP-CN-, 00122 - Fifthist Memetics
SCP-CN-145 - Hometown
SCP-CN-161 - Interpreter
SCP-CN-166 - Embryos
SCP-CN-171 - Dormitory Manager
SCP-CN-176 - Uncle Sweets
SCP-CN-180 - SPEEDCORE GENERATOR!!!
SCP-CN-204 - Thunder Trial
SCP-CN-233 - Dot Matrix
丂匚卩句丹丂卄匚几句丹丂卄丅山口几丨几乇丂丨乂 - 卄丹几乙丨从乇从乇
SCP-CN-312 - What Does She Know?
SCP-CN-326 - ~~In Fading Books~~ A Digital Music Fantasy Is Reborn
SCP-CN-366 - Exist
SCP-CN-369 - Self-Declaration Rostrum
SCP-CN-404- Memetic Immunity Disease
SCP-CN-412- Beauty Camera
SCP-CN-440- Immortals of the Table
SCP-CN-444 - Heavenly Sounds
SCP-CN-445 - A Failed Anomalous Document
SCP-CN-475 - Entombing
SCP-CN-514 - Insomnia
SCP-CN-529 - No Longer Human
SCP-CN-534 - Mr. Dialect
SCP-CN-546 - Our Secrets
SCP-CN-661 - Dick, St. Dick
SCP-CN-666 - Hold the Bottom Line
SCP-CN-673 - A bunch of statues what move when you dun look at dem
SCP-CN-675 - The Great Kyet Khaewt Device
SCP-CN-678 - Stranger
SCP-CN-713 - Keyboard Fish
SCP-CN-717 - Throat Forest
SCP-CN-731 - Black Sunset
SCP-CN-756 - Book of Numbers
SCP-CN-757 - Tiny World
SCP-CN-758 - Mini-Foundation
SCP-CN-767 - Chart Syndrome
SCP-CN-797 - The Wandering Train
SCP-CN-805 - Magic: The Gathering
SCP-CN-810 - "Gold Foil"
SCP-CN-829 - Spherical Potatoes
SCP-CN-844 - The Seed of Lovesickness
SCP-CN-861 - The pedestrian in a painting
SCP-CN-879 - Programmable Office Building
SCP-CN-918 - ~~Ever-Drifting~~ Paper Plane
SCP-CN-937-J - A Useful Toilet
SCP-CN-964 - I'll turn on the Bluetooth and listen to some tunes
SCP-CN-985 - Exam Shark
SCP-CN-999 - Spreading Your Wings
SCP-CN-1000 - 2300
SCP-CN-1001 - Writing Ends Here
SCP-CN-1050 - "Aquarius"
SCP-CN-1076 - "Have another bottle"
SCP-CN-1080 - A Silent Bell
SCP-CN-1099 - ~~Tin of Sardines~~
SCP-CN-1123 - CTTGGGAGATGAATAGATGGGTTGCAACCCATCTATT……
SCP-CN-1138 - Anime Must Be Destroyed
SCP-CN-1145 - A Nonexistent Elevator
SCP-CN-1174 - Royal Quiet Deluxe Typewriter
SCP-CN-1256 - SCP Foundation Chinese Branch Chronicle
SCP-CN-1260 - Origin of Species, or Machinery of Creation
SCP-CN-1276 - "Zekkōchō Conveyor Belt Sushi Restaurant!"
SCP-CN-1391 - hamster pill by dado
SCP-CN-1409 - 4200006200
Work Notes: SCP-CN-1417
SCP-CN-1424 - not spicy mouthwash by dado
SCP-CN-1463 - Catgirl Training Plan
SCP-CN-1483 - Those distant, cold stones
SCP-CN-1500 - pʰoʃma
SCP-CN-1537 - Storytelling
SCP-CN-1604 - A Gun That Gets More Powerful As It Kills More People
SCP-CN-1621 - become cat pill by dado
SCP-CN-1666 - Veilbreak
SCP-CN-1691 - A machine looking for loved ones
SCP-CN-1733 - The Empty Patches of Sky
SCP-CN-1767 - What is Papa's Mama Called?
SCP-CN-1780 - Red Light, Green Light
SCP-CN-1831 - Human-repelling Incense
SCP-CN-1835 - The day the music died. Except for you.
SCP-CN-1837 - USB Sword
SCP-CN-1920 - J-Q-X, three brothers, see fish eyes and dig them out
SCP-CN-1976 - Little Red Book
SCP-CN-1987 - Plunger
SCP-CN-1997 - When Magic and Science Intersect
SCP-CN-2019 - Forbidden Borderline Θ
SCP-CN-2035 - Terminal Entertainment!
Riddle-2109: God
SCP-CN-2176 - Zero-Calorie Biscuits
SCP-CN-2200 - Hyper Dimension Action
SCP-CN-2215 - A Literary Opinion
SCP-CN-2227 - Drunk Alone
SCP-CN-2270 - Rainbow Mount
SCP-CN-2300 - 1000
SCP-CN-2304 - The Sun is Tired of Rising
SCP-CN-2345 - Memory-Carrying Enoki
Observation File #CN-2380 - When Spring Comes
SCP-CN-2399 - Still Raining
SCP-CN-2401 - Sick Hall
SCP-CN-2402 - The Star Nearby
SCP-CN-2403 - Dodgeball
SCP-CN-2405 - Ronald McDonald
SCP-CN-2406 - … would much rather have KFC!
SCP-CN-2426 - McNugget Fundamentalism
SCP-CN-2440 - A video of torturing tubers
SCP-CN-2517 - A Man Who Can~~not~~, In Fact, Fly
SCP-CN-2620 - Birthday
SCP-CN-2626 - D4C
SCP-CN-2631 - Aliens Speaking English
SCP-CN-2636 - MTF-己申-20 ("We")
SCP-CN-2740 - ~~Addictive Minecraft, Sentient NPCs~~, Digital Lies, Longing for Reality
SCP-CN-2752 - I See the Machine Core Before the Mechanical Revolution
SCP-CN-2781 - Before Sleeping
SCP-CN-2806 - Slickness
SCP-CN-2835 - Where am I?
SCP-CN-2878 - Very Annoying Mosquitoes
SCP-CN-2879 - Very Big Strainer
SCP-CN-2880 - Very Sharp Sword
SCP-CN-2918 - The Pleasant Sound of Rain
SCP-CN-2926 - Big Prime Number
SCP-CN-2980 - Your Copper Sulfate Friend
SCP-CN-2987 - Don't Look Up
SCP-CN-2989 - DEMONSTRATION OF THE PRECENCE
SCP-CN-2991 - Why disbelieve ye in the revelations of Anormaly, when ye bear witness
SCP-CN-116-EX - A Dazzling, Lively Relic
SCP-CN-3300-EX - The Lamb has Died
SCP-CN-123-J - How Many Urinals Do We Need?
SCP-CN-213-J - The Magical Geoduck
SCP-CN-404½-J - "The Foundation is FAKE!"
SCP-CN-421-J - The Great Radish
SCP-CN-555-J - Hurts Like Hell!
SCP-CN-666-J - Mew Mew Mew
SCP-CN-963-J - Extremely Annoying Codes
SCP-CN-1616-J - WTF YOU SAID YOU DIDNT REVIEW
SCP-CN-2000-J - Foundation's Bizarre Black-Technologies
SCP-CN-2719-J - "Waifu"

Французский филиал

CODE NAME: Dr. Gray - Not all angels have wings
CODE NAME: Dr. Johannes - Program Xibalba
SCP-014-FR - Agent of Chaos
SCP-021-FR - Lights of the Cliffs
SCP-027-FR - "Get Rick Rolled"
SCP-031-FR - The Knowledge-Eaters
SCP-043-FR - Blind Wanderer
SCP-045-FR - Thieving Arthropod
SCP-059-FR - Blizzard's Claws
SCP-060-FR - The Lich
SCP-061-FR - The Kiwi
SCP-073-FR - Biological Sterilizer
SCP-089-FR - The Athena Project
SCP-095-FR - The Demon Core
SCP-113-FR - ~~Infected file~~ S.O.S. - Dr. Anton Vehan
SCP-116-FR - Trabant 601 S "Hermes"
SCP-125-FR - Mark IV
SCP-137-FR - The One True Religion
SCP-143-FR - Mesozoic chicken coop
SCP-150-FR - Vox
SCP-155-FR - Wake up
SCP-161-FR - The Book And The Beast
SCP-164-FR - Creationism
SCP-172-FR - "Points of View"
SCP-181-FR - Non-recyclable
SCP-185-FR - Kinetic Inverter
SCP-192-FR - Your question
SCP-197-FR - Gardener Tortoises
SCP-198-FR - Considerations on the Causes of the Greatness of Mankind and its Decline
SCP-201-FR - Mind Palace Syndrome
SCP-213-FR - The Vagabonds of the Dark Forest
SCP-215-FR - Industrial Sardine
SCP-218-FR - The Antiquity Manufacturer
SCP-227-FR - Horoscomaton®
SCP-233-FR - The Pillow That Makes You Sleep
SCP-237-FR - Absurd Instability
SCP-281-FR - The Day The Earth Stopped Being Flat
SCP-291-FR - Containment Procedures Updated
SCP-296-FR - Dusk on Mars
SCP-299-FR - 113-B
SCP-320-FR - Life is a pillow
SCP-324-FR - He Died Thrice
SCP-327-FR - Foresight Cameras
SCP-335-FR - Lacrymodjinn
SCP-347-FR - Risky Driving
SCP-361-FR - Matriarch
SCP-375-FR - Proof of the existence and uniqueness of the Self
SCP-400-FR - She's Too Beautiful to be True
SCP-403-FR - Güiro in Exile
SCP-418-FR - Maurice the Concept-Eating sheep
SCP-445-FR - Monkey See, Monkey Shoot
SCP-466-FR - The Cottage Pottage
SCP-471-FR - Riders on the Storm
SCP-476-FR - Molecular Voodoo Dolls
SCP-484-FR - Billy the Euc-kid
SCP-503-FR - An Imperfect Allegory
SCP-505-FR - Before Aleph
SCP-510-FR - 5 Stars
SCP-540-FR - The Grass is greener
SCP-555-FR - The SCP Religion
SCP-569-FR - Dimensional gloryhole
SCP-589-FR - The Lamppost Song
SCP-192-FR-J - Chicken that runs like really really fast
FCP-676-FR-Vay - Exftremely Danverouf Viruf
SCP-1054-FR-J - Schisms
SCP-SKIP-FR-J - Skip For Long Optimal Multifunction Whiteness ©

Польский филиал

CODE NAME: ZeroStrider — Wingless Birds
SCP-PL-007 - Happily nonexistent object
SCP-PL-023 - Written World
SCP-PL-030 - The Mulch
SCP-PL-037 - The Haunter
SCP-PL-052 - Subtemporal bracer
SCP-PL-057 - Leccinum Disappearing
SCP-PL-066 - Trapdoor in a storeroom
SCP-PL-067 - Dog that traveled in time
SCP-PL-078 - Earrings of Instant Meetup
SCP-PL-086 - I know about the Foundation
SCP-PL-091 - Calcumuttons
SCP-PL-144 - Analogue Virtual Reality
SCP-PL-149 - The Cinema
SCP-PL-150 - On vacations
SCP-PL-152 - Pet snakes
SCP-PL-160 - Fat Burner
SCP-PL-166 - Cemetery lights
SCP-PL-173 - Fungal sounds
SCP-PL-174 - R'EALITYBLENDER™
SCP-PL-180 - Those who embark with us
SCP-PL-183 - Lust of Speed
SCP-PL-186 - Art is Death
SCP-PL-195 - Gift from a friend
SCP-PL-200 - Responsible Reading
SCP-PL-203 - Weather for 2033
SCP-PL-204 - How to Disappear Completely and Never Be Found
SCP-PL-213 - Gloria Necatis
SCP-PL-231 - The Wrath of Perun
SCP-PL-248 - Heraclitic Tears
SCP-PL-253 - WHAT IN THE KENTUCKY FRIED FUCK
SCP-PL-259 - The list of territories conquered by Genghis Khan is incomplete, you can help by expanding it
SCP-PL-260 - We know where you live
SCP-PL-262 - A
SCP-PL-267 - Mieszko, Mieszko, mój koleżko
SCP-PL-284 - Oh God, oh fuck
SCP-PL-289 - A Multidimensional Solution For Shopping at Biedronka
SCP-PL-290 - Empiricism
SCP-PL-121-J - Diego the Turtle
SCP-PL-2004-J - The very fast vehicle of anthropomorphic amphibian
SCP-PL-2021-J - The hope for our world
SCP-PL-6470-J - Cat meme [DANGEROUS]

Испанский филиал

CODE NAME: Uncle Nicolini - The Nexus of Babel
SCP-ES-038 - The Bussinesman
SCP-ES-039 - Satellipeople
SCP-ES-040 - Polaris Leporidae
SCP-ES-044 - Necrofauna Arthropoda
SCP-ES-048 - The Power of Ideas
SCP-ES-054 - The Garden Gnome Gardeners
SCP-ES-058 - Stilhed Overalt; Silence Everywhere
SCP-ES-059 - Thirteen Little Fingers
SCP-ES-069 - The Twine upon the Fate of her Appeal to Look
SCP-ES-070 - Narcissus and the Plain of the Arrows of Eros
SCP-ES-076 - https://www.youtube.com/watch?v=fgm14D1jHUw
SCP-ES-081 - Gluttony
SCP-ES-083 - deCipher'em All v1.6
SCP-ES-087 - Sandbox; Intentional Continental Drift; I don't know biology so I'll turn fish into birds.
SCP-ES-089 - The Last Emperor of Hoiohiña
SCP-ES-090 - Nine Lights Emissary
SCP-ES-091 - Eugenics Nightmare
SCP-ES-095 - A Victimless Crime
SCP-ES-096 - THE GALLEON, or; Hunt the Dutchman! Or; The Assfuckedship
SCP-ES-097 - Fungi Reactor
SCP-ES-098 - Kynodontos
SCP-ES-099 - The Piano Concert
SCP-ES-100 - For Your Safety, Please Use the Stairs
SCP-ES-101 - Ye Shall Not Worship False Gods
SCP-ES-102 - The Cage
SCP-ES-103 - Frustrated Musician
SCP-ES-105 - Stargazing The Other Stars
SCP-ES-107 - Partnercaller3000
SCP-ES-111 - An explorer fallen from somewhere else
SCP-ES-112 - 🤑🔫 pay 2 win 🔫🤑
SCP-ES-113 - Special Deal
SCP-ES-115 - This is the Metro of Franco's Spain
SCP-ES-116 - A Gossiper Gramophone
SCP-ES-117 - A second chance
SCP-ES-119 - The Ministry of Abnormalities of Cuba
SCP-ES-120 - This Sickness Will Not Defeat Me
SCP-ES-122 - greatGreenishGreenery v1.01
SCP-ES-123 - Aurus Trading Company
SCP-ES-125 - North Korean Orbital Bombardment System
SCP-ES-132 - The Wall; The Selective; The Thing That Kills You; We Don't Let Fools In; The Witch Burning; The Booby Trap; Stress; These Fools Don't Learn; We Have The Key; The Key; I Need Sleep; Sometimes, A Break; Sometimes, A Life; Merlín
SCP-ES-133 - The Green One always finds its way
SCP-ES-136 - Penitent Cry
SCP-ES-137 - Sadness
SCP-ES-142 - The Bones of the Saints
SCP-ES-143 - May the Light of St. George lead us to Victory
SCP-ES-145 - Funerary Licentiousness
SCP-ES-146 - Who am I?
SCP-ES-147 - Cessation of Legacy
SCP-ES-152 - The Fall of the Fools
SCP-ES-157 - Coppélia
SCP-ES-158 - And the Potatoes Took Over the Earth
SCP-ES-163 - Elephant Graveyards
SCP-ES-165 - Kaiju Sarcophagus
SCP-ES-169 - The Hentai Dream Made True
SCP-ES-173 - The last sacrifice to Vulcan
SCP-ES-178 - The best re-union you will never have.
SCP-ES-180 - It's not yours, it's ours
SCP-ES-181 - The King Who Burnt
SCP-ES-184 - Vitrified Fortresses
SCP-ES-185 - Space Swallow
SCP-ES-186 - Absolute Corruption of Power
SCP-ES-191 - Stellar Garden
SCP-ES-193 - On the 13th of April, 2013, a Train Fell From the Sky
SCP-ES-194 - That motherfucker Fidel Castro just won't stay dead!
SCP-ES-196 - Buried Dreamers
SCP-ES-199 - Institution for Dealing with Your Issues of Normalcy
SCP-ES-200 - Mind Control Ball Cactus
SCP-ES-201 - Theatrum Mundi
SCP-ES-202 - What is HANSARP?
SCP-ES-203 - Super Golden Fruit
SCP-ES-208 - Flying Pigs
SCP-ES-216 - Lutiya, Pillar of Silence
SCP-ES-220 - Burning Soul
SCP-ES-230 - EAGLE Protocol
SCP-ES-232 - Gramophone Gal (Do You Like Gramophones?)
SCP-ES-234 - Detective Marw, Private Eye
SCP-ES-245 - Autarchy of Atonement
SCP-ES-250 - First Parca: Sons of the Harvest
SCP-ES-251 - Second Parca: Tales of Misery
SCP-ES-252 - Third Grim Reaper: The Life of Death
SCP-ES-256 - At midnight
SCP-ES-260 - The Blue Eyes of Gea
SCP-ES-261 - The taste of the stars and the desolation of Juno
SCP-ES-262 - RAVEYARD
SCP-ES-264 - A Friendly Crab
SCP-ES-266 - Scavenger Jellyfish
SCP-ES-268 - Electromagnet-shrooms
SCP-ES-284 - A, last? regret
SCP-ES-288 - Who is that walking beside you?
SCP-ES-290 - Wrong Taxi
SCP-ES-296 - The Path From Which We Come From
SCP-ES-297 - 🌮🔔
SCP-ES-100-EX - Mother Nature
SCP-ES-112 Extended Testing Log
Document-ES-061-B
SCP-RU-178 - The Heroes Of Vólorovsk
Proposal by Nico, Who Has Gone A Little Crazy
SCP-ES-I don't care-J - I don't care
SCP-ES-050-h2o-J - Bears are better than crocodiles. Probably.
SCP-ES-101-J - The Hard-To-Open Container
Emily Miranda Sends Nudes

Тайский филиал

CODE NAME: DrSSS - Another World Comers
SCP-009-TH - Human Anatomy Model
SCP-043-TH - Human Ice Cream
SCP-072-TH - The Castle Guards
SCP-400-TH - The Elephant is a Blood-thirsty Animal
SCP-412-TH - The Lattice (The Hydrologic Cycle)
SCP-747-TH - The Black Box
SCP-901-TH - The Giant Head
SCP-903-TH - Very Huge Dinosaur
SCP-025-TH-J - Stop for Inspection Sign
SCP-222-TH-J - ~~The Troll Cat~~ The Genius Hacker Cat

Японский филиал

CODE NAME: solvex - Acquittal and Miniascape
CODE NAME: amamiel - Ave Maria
CODE NAME: indonootoko - Arahitogami
CODE NAME: k-cal - ~~The Balance Scales~~ The Handover Report You Want
SCP-010-JP - "Mirai PC"
SCP-017-JP - Local Rules
SCP-020-JP - Winged Human
SCP-023-JP - Shadow Railway Line
SCP-030-JP - Petroleum Devourers
SCP-043-JP - Seasoning that Makes Anything Edible
SCP-047-JP - "For the Greatest Music"
SCP-065-JP - ~~from today on i am the prime minister~~ All We Need Is Dominator
SCP-076-JP - Terror Overhead
SCP-082-JP - To the Desired Country
SCP-086-JP - Zombie Virus
SCP-088-JP - Babies Can Choose Their Moms and Dads to Be Born to
SCP-094-JP - Marine Man
SCP-095-JP - Satō Saitō
What is SCP-105-JP? I've investigated it in my own way!
SCP-115-JP - Nue
SCP-120-JP - The World's Most Valuable Jewel
SCP-132-JP - One Fish, Two Fish, Paper Fish, Silverfish
SCP-167-JP - Restaurant Seashore
SCP-181-JP - Effective Advertising
SCP-184-JP - Worn-Out Utility Pole
SCP-194-JP - Paradise Inside a Memory
SCP-199-JP - Another Audience
SCP-266-JP - A Town Without Anyone
SCP-268-JP - The Never-Ending Epic
SCP-272-JP - "Floora"
SCP-277-JP - Feigning Death Tank
SCP-333-JP - The Earthlings
SCP-359-JP - Penguin Mushroom
SCP-373-JP - Manufacturing Group
SCP-398-JP - Eternal Room 105
SCP-407-JP - A Tub
SCP-419-JP - An Alternate History of Easter Island
SCP-444-JP - █████[ACCESS UNAUTHORIZED]
SCP-475-JP - I Want to See Only Beautiful Things
SCP-496-JP - Warning: Electronic Protocol in force when viewing this document
SCP-522-JP - Airborne Baguette Concentration Measurement Station
SCP-534-JP - Get a Glass for Flea
SCP-546-JP - Sugar and Spice and All That's Nice
SCP-548-JP - Singing Rain Sounds
SCP-557-JP - Déjà Mort
SCP-558-JP - Bunch o' Chicks 'n' BIG MAMA
SCP-569-JP - Konpeight
SCP-571-JP - NIGIRI OF THE DEAD
SCP-583-JP - Darkness of the Remembrance
SCP-586-JP - Snow Globes Past the Sell-By Date
SCP-588-JP - Transdimensional Buttock Wall ~ A Karcist's Ass Sticking Out Into Our Universe ~
SCP-632-JP - Human Internal Ants
SCP-646-JP - A Retro-bender
SCP-654-JP - Matryoshka
SCP-656-JP - Human Repellant Plastic Bottles
SCP-671-JP - The Night of Electric Jellyfishes
SCP-682-JP - Tough Microbe
SCP-737-JP - Merciful Jewelry Workshop
SCP-747-JP - How To Boil Some Eggs In This Shifting Universe
SCP-751-JP - EVERYBODY,FUCK YOU
SCP-787-JP - How Those Vacuous Spines Got So Close To You
SCP-818-JP - How great-
SCP-828-JP - Launching Site
SCP-830-JP - Downfall of One Night Castle
SCP-831-JP - Lurking Summer
SCP-835-JP - ~~Xenophobia~~ Keteru Yamiko
SCP-838-JP - Urban Waves
SCP-903-JP - Mr. Kojirō feat. Joyful Dancers
SCP-905-JP - Freddie’s Special Flight Show
SCP-918-JP - That's Someone else's Lost Dreams
SCP-922-JP - Animal Relocation
SCP-926-JP - Oneiric Eternal Recurrence Of The Nightmare Beast
SCP-949-JP - Overrunning Bulldozer
SCP-981-JP - Wenkankanhoyaukamuy
SCP-1012-JP - Inversive Monotony
SCP-1020-JP - Feeding Bowl for Chucky
SCP-1044-JP - For Those Who Will Listen
SCP-1045-JP - Corrective Lenses
SCP-1078-JP - Less Guilt-Provoking Laboratory Organisms
SCP-1100-JP - CAPTCHA
SCP-1118-JP - Tokyo DisneySky
SCP-1134-JP - Explosive Nigiri Sushiblade
SCP-1139-JP - Electronic Diva
SCP-1201-JP - Lakebed Electronics Store
SCP-1242-JP - Abyssal Toilet Stall
SCP-1249-JP - People
SCP-1299-JP - They're All Alive
SCP-1300-JP - An Offering to S
SCP-1302-JP - Revolving.
SCP-1304-JP - The Day the Wild Thistle Fell
SCP-1305-JP - Infinite Monkey Would Never Abuse Drugs
SCP-1330-JP - Crackti
SCP-1332-JP - Mule at the Edge of the World
SCP-1334-JP - Towards the Beach
SCP-1357-JP - Kingfisher, Shining As Bright As Fire
SCP-1379-JP - annoying omnipotent
SCP-1405-JP - British White Silver Garden
SCP-1407-JP - Chicks could remember
SCP-1431-JP - I Really Wanna make them into Moss.min.js
SCP-1440-JP - と
SCP-1444-JP - Reenacting Proof for the Sake of Pleasure
SCP-1475-JP - Target North Carolina!
SCP-1494-JP - The Roadkill is Always Watching Over Us
SCP-1495-JP - The Bystander is Only Watching for All Time
SCP-1548-JP - You Offend My Eyes
SCP-1566-JP - When the Body Dies, the Mind Also Dies; and When the Mind Dies, the Body Is As Good As Dead
SCP-1576-JP - Hence the God Exists
SCP-1577-JP - The Cow Lay Down On The Grass Because It Was So Starving
SCP-1579-JP - A Man's Neighbor
SCP-1581-JP - Graveyard is Full of Balloons
SCP-1646-JP - Everything is in a Dream
SCP-1657-JP - Eyedrops From the 2↑↑↑↑2nd Floor
SCP-1673-JP - Moses and the Hot Springs
SCP-1677-JP - Space Jumper
SCP-1687-JP - With You, Someday/Eternally
SCP-1690-JP - Tān, or Ouroboros
SCP-1693-JP - Birth of the Prison
SCP-1709-JP - Katana of Poetic Justice
SCP-1710-JP - CHOPIN GODZILLA
SCP-1721-JP - Love-Doll Retriever
SCP-1732-JP - Toutei - Invitation
SCP-1748-JP - Someday Somewhere
SCP-1774-JP - Natural Apple
SCP-1783-JP - The Ship is Full of Rabbits
SCP-1792-JP - Guillotine Lemonade, Friendly Price 25¢
SCP-1803-JP - Perpetual Generator, or a Black Box
SCP-1810-JP - QR Bird
SCP-1828-JP - Foggy Forest
SCP-1841-JP - Don't Get Off Your Pedestal
SCP-1857-JP - Cherry Blossom of Permanence
SCP-1866-JP - A Job to Save the World
SCP-1868-JP - Freed Headless Feline Carcasses (they can't go anywhere in the first place, and the neighbors don't give them a shit)
SCP-1873-JP - Yoke of Flesh
SCP-1876-JP - Out of Mom
SCP-1934-JP - Shiba Inu on the Suspension Bridge
SCP-1936-JP - This Connection Has Been Severed by a Nightmare Collective
SCP-1944-JP - Unfortunate Flying Object
SCP-1977-JP - Death Got A Non-Aquaphobic Horse
SCP-1978-JP - Sailor Suit and Machine Gun
SCP-1988-JP - Heisei Convenience Store Myths
SCP-1995-JP - Ushi-Gozen
SCP-1998-JP - A Girl Who Changes Shape with Extreme Force and a Super Deranged YouTuber
SCP-2005-JP - Sword of Judgement, Bell of Forgiveness
SCP-2048-JP - An Ordinary Coin
SCP-2057-JP - Back to the Egg, Then It Hatches
SCP-2061-JP - Adventure Tale at Gyouseiya Department Store
SCP-2077-JP - Turing Shredder
SCP-2113-JP - And He Closed His Eyes
SCP-2152-JP - Tranquility, Anxiety, Drinking Down into the Darkness
SCP-2170-JP - Oneigal Upload
SCP-2188-JP - Light Fingers with a Ready Tongue
SCP-2200-JP - BBC
SCP-2203-JP - Reset
SCP-2211-JP - Foundation Department of Hell
SCP-2227-JP - Tell Me Stories
SCP-2233-JP - He Who Was Mourned By As Many People As Possible
SCP-2300-JP - Whether I Stay or Not, I May Never Go Anywhere
SCP-2351-JP - Virtue's Vengeance
SCP-2371-JP - Soytaurus
SCP-2403-JP - Invasive Species Throwing Dude
SCP-2422-JP - Language Kusōzu
SCP-2424-JP - Lincoln Century
SCP-2426-JP - Won't You Jump Out At Me From That Corner?
SCP-2429-JP - Pufferfish Eten
SCP-2433-JP - Wrongful Indulgence
SLOT UNALLOCATED - That Which Kills Me
SCP-2459-JP - It Must Be a Warm Place That Leads to Hell
SCP-2472-JP - Nyankoderoga
SCP-2476-JP - cat.exe (Modification Prohibited)
SCP-2493-JP - Broken Smile
SCP-2503-JP - Those Who Wait for Absolute Zero
SCP-2505-JP - Processed Quail
SCP-2507-JP - Jumpscaring Ghosts
SCP-2513-JP - At Least, Be the Foundation
SCP-2566-JP - RETURN PARADOX
SCP-2580-JP - The Great Death
SCP-2581-JP - Make Me Look Pretty☆
SCP-2601-JP - "Me, and Yayoi, and Miyuki, and…"
SCP-2613-JP - Fear Conditioner
SCP-2626-JP (SCP-262-IE) - Casadh an tSúgáinTangled Thread
SCP-2642-JP - Making "Project Arca"
SCP-2650-JP - Transfeuneral
SCP-2687-JP - Meaning of Life/Meaning of Death
SCP-2707-JP - Floral Tribute for Me
SCP-2733-JP - The Road To Hell Is Paved All Over With Good Intentions, Even Having Information Signs
SCP-2744-JP - てるてるネコちゃん
SCP-2755-JP - A Star at the Bottom of a Lake
SCP-2760-JP - Dazzling with gold
SCP-2784-JP - Someone is Talking About You Somewhere
SCP-2788-JP - Your nth Dead Grandma
SCP-2790-JP - Foundation Department of Retention
SCP-2833-JP - SKYWELLS: THE SECOND
SCP-2840-JP - The Room
SCP-2844-JP - Cognitive Dissonance
SCP-2851-JP - No Longer Red Needed
SCP-2855-JP - SKYWELLS: THE FIRST
SCP-2856-JP - My Hero
SCP-2880-JP (Unassigned Number)
SCP-2891-JP - Interstellar Retribution
SCP-2904-JP - How Many Pigs Have You Ever Murdered?
SCP-2920-JP - Strangulation Demon
SCP-2955-JP - Septette for the Dead CN-Aniki
SCP-2973-JP - The Man with the Most Powerful Abilities Ever
SCP-2975-JP - "Cuz When I'm Up Late, I Wanna Eat Somethin'"
SCP-2989-JP - The Star of My Wish Rises in the Clear Blue Sky
SCP-666-JP-J - The Ultimate Horrible Object
SCP-999-JP-J - The Tickle Master
SCP-Shrimp-JP-J - ＞ A saury ＜
SCP-K2-JP-J - Oh shit !!!
5Ç卩-譁?ｭ怜喧縺-JP-J - Untellable
SCP-014-JP-EX - I Just Wanted to See that Look on your Face

Немецкий филиал

SCP-009-DE - Cheap Gas
SCP-015-DE - Dr. Duck
SCP-017-DE - R.T.I. Grizzly A1
SCP-028-DE - Sonderkommando for the paranormal
SCP-030-DE - R.T.I. Hammer P1
SCP-031-DE - Isabelle
SCP-034-DE - Shower of dread
SCP-042-DE - Avoid Containment
SCP-045-DE - What are you searching for?
SCP-046-DE - Shuffling Corpse
SCP-051-DE - Mr. Soother
SCP-056-DE - R.T.I Sentinel
SCP-058-DE - Peaceful Zombies
SCP-066-DE - The little Spellbook
SCP-070-DE - Pink Colony
SCP-076-DE - Face-Swap App
SCP-083-DE - Badge of Physical Fitness
SCP-087-DE - Confused AI
SCP-089-DE - The Athena Project
SCP-090-DE - I‘m SCP!
SCP-091-DE - The Loving Doll
SCP-096-DE - A Cosmic Phenomenon
SCP-098-DE - Demon vs Machine
SCP-099-DE - Gasmen
SCP-100-DE - The gargoyle's misdeeds
SCP-101-DE - Eik, the Tree of Knowledge
SCP-117-DE - The News of the Day to Come
SCP-121-DE - Telepathic humanoid
SCP-122-DE - Frau Harlekina
SCP-124-DE - Don't notice me
SCP-125-DE - The Imprisoned Regent
SCP-131-DE - Real Estate Shark
SCP-136-DE - The boy who stops time.
SCP-137-DE - Ice Phoenix
SCP-140-DE - Morts volantes
SCP-148-DE - Blue Slime [Level 25]
SCP-149-DE - The Spirit of Ruin
SCP-150-DE - Die Verteidiger
SCP-173-DE - Hating Stones
SCP-177-DE - The Rungholt Shard
SCP-178-DE - Dreamlike Weather
SCP-179-DE - To the most Righteous
SCP-180-DE - A little cute Birthdaypenguin
SCP-184-DE - Arachnophilia
SCP-186-DE - The True Meaning of Christmas
SCP-187-DE - Mathilda
SCP-188-DE - B4 “Blitzgewitter”
SCP-190-DE - Thor, God of Kebab
SCP-192-DE - "Knowledge"
SCP-200-DE - Higher Mathematics
SCP-201-DE - Metal Dragon
SCP-204-DE - The Chest of Eternity
SCP-207-DE - The heart of Cupido
SCP-208-DE - St Caesarius Hospital
SCP-209-DE - The idiot box
SCP-226-DE - Knight Cuddle Steel
SCP-227-DE - Moo
SCP-234-DE - A Christmas miracle
SCP-236-DE - A cup of love
SCP-237-DE - Her heart and his soul
SCP-239-DE - USB Jird
SCP-248-DE - Omni fork
SCP-255-DE - The Perfect Mascot
SCP-257-DE - A butt ugly owl
SCP-260-DE - Ahead of her time
SCP-272-DE - Megalodon
SCP-281-DE - A pretty good hotel
SCP-292-DE - Sweet Easter
SCP-293-DE - Aliens, go home!
SCP-296-DE - In death we blossom
SCP-297-DE - Combustible Deep-Sleep
SCP-299-DE - What the Future Holds
SCP-004-DE-EX - Repulsive
SCP-015-DE-J - This is why the SCP Foundation hates Ducks and Geese
SCP-027-DE-J - The Big Bad Tap Hen
SCP-033-DE-J - Earworm
SCP-044-DE-J - This damn schnapps
SCP-(INSERTANYNUMBERHERE)-DE-J - The Trainee
The Things Dr Ore Is Not Allowed To Do At The German Branch Of The Foundation

Итальянский филиал

CODENAME: /GRAF - The Dragon Of Revelation
CODENAME: /ABAD - The Values Of The Fatherland
SCP-002-IT - The Voice of the Piave
SCP-010-IT - Parental Care
SCP-011-IT - The Zero Zone
SCP-012-IT - Waltz No. 2
SCP-013-IT - Sentient Tornado
SCP-015-IT - The Boogeyman
SCP-017-IT - Sentient USB Pendrive
SCP-018-IT - EMP Barn Owl
SCP-019-IT - E-15 Chimera
SCP-020-IT - Horse with Oratory Skills
SCP-021-IT - The Capitoline Wolf
SCP-022-IT - Legion
SCP-023-IT - Hounds of the Dictator
SCP-024-IT - Rebar ಉ
SCP-025-IT - Kangaroo Mother
SCP-029-IT - The Last Vestal
SCP-032-IT - Haruspex
SCP-035-IT - The Hammer
SCP-037-IT - Subtle Vibration
SCP-038-IT - Ocean Stones
SCP-039-IT - Cordless Telephone
SCP-041-IT - A Flat World
SCP-042-IT - The Answer
SCP-045-IT - The Hypogea of the Daunia
SCP-050-IT - The Galleass
SCP-054-IT - Microcosmos
SCP-055-IT - The Devourers
SCP-057-IT - Under the Sea
SCP-066-IT - Diabolus ex Machina
SCP-067-IT - The King of the Hill
SCP-068-IT - Kaliperia
SCP-070-IT - Forgotten Depths
SCP-071-IT - Ötzi's cloak
SCP-079-IT - Locus Amoenus
SCP-080-IT - Shattered Civilization
SCP-082-IT - The Helmet of Knowledge
SCP-100-IT - Carnem Levare
SCP-103-IT - Ciapapuer
SCP-105-IT - Anachronistic Hallucinogenic Excrements
SCP-149-IT - After the End of the Eternity
SCP-004-IT-ARC - Infinite Tuning Guitar
SCP-008-IT-ARC - The Hotel
SCP-014-IT-ARC - XXXIII (Before Rewrite)
SCP-001-IT-J - The “Dragon” Of Revelation
SCP-002-IT-J - The Doctor-Destroyer
SCP-610-IT-J - The Perfect Projectile
SCP-1900-IT-J - The Pirate Kingdom
SCP-F2Y-IT-J - The [EXPLICIT]
Italian Sites -J - The best Sites of the Italian Branch!

Украинский филиал

SCP-012-UA - The Library
SCP-035-UA - Tablet of Veles
SCP-038-UA - Alike to black holes
SCP-046-UA - Tasty flashbacks
SCP-049-UA - Apparently… God?..
SCP-054-UA - Pater noster Bandera
SCP-056-UA - Pit on the road
SCP-065-UA - Deliver Us From Evil
SCP-069-UA - Cast-iron charcoal iron
SCP-079-UA - No-Sides
SCP-081-UA - Vanka-Vstanka
SCP-095-UA - Crazy Bee
SCP-2014-UA-EX - SCP-2014-RU
SCP-692-UA-J - Connection cockup

Португальский филиал

CODINAME: Project Bulwark - by slashannemoo & Vintner
SCP-002-PT - Women's Magazine
SCP-003-PT - Silent Droplets
SCP-004-PT - The Soldier and the Bomb
SCP-006-PT - Freefalling Nightmare
SCP-008-PT - Man-Man
SCP-010-PT - Peppers
SCP-011-PT - Victoria stella
SCP-013-PT - Crazy Cyborg's Samba
SCP-014-PT - Improvised Appearances
SCP-015-PT - Electromagnetic Cannon
SCP-016-PT - The Holy Grail
SCP-018-PT - Unrecorded Man
SCP-019-PT - Porcelain Dish
SCP-021-PT - Crystal Theatre
SCP-022-PT - Lawyers = Fairies and Vice Versa
SCP-023-PT - Xeno's Paradox
SCP-024-PT - A Longtime Friend
SCP-025-PT - Portable Desert
SCP-026-PT - Sober Drunk
—————— - This Shouldn't Exist
SCP-030-PT - Cultural Heritage
SCP-031-PT - Pocket Imp
SCP-034-PT - Creator Magnifying Glass
SCP-035-PT - The Pigeon
SCP-038-PT - Floating Snake
SCP-040-PT - Ostium Theater
SCP-041-PT - A Weapon Among the Stars
SCP-042-PT - The ████ Opener
SCP-043-PT - The Player
SCP-046-PT - Read a Book, Write a Book
SCP-049-PT - <N0:.WH3RE>
SCP-050-PT - The Sack Man
SCP-055-PT - Adaptive Tactical Armour for Containment and Assault
SCP-057-PT - The Abandoned Hospital
SCP-065-PT - Hard-to-Kill Armadillo
SCP-078-PT - The Fog
SCP-079-PT - Schrödinger's Planet
SCP-088-PT - This Machine Kills Commies
SCP-089-PT - I Shall Deeply Love You
SCP-094-PT - Apamachi Identity Camouflage Device.
SCP-101-PT - Manor of Madness
SCP-106-PT - Sonic Flashlight
SCP-110-PT - A Very Convincing Story
SCP-118-PT - That Which Shares
SCP-119-PT - The Pompous Girl
SCP-122-PT - Factor XX
SCP-143-PT - Escape from the Rio-Niterói Bridge
SCP-150-PT - P███ G████´s Progressive Location Pen
SCP-166-PT - The Light of the Court
SCP-170-PT - [31/12/2025]: thank you.
SCP-172-PT - Mother-of-Gold
SCP-177-PT - Time Travelling Lottery
SCP-191-PT - Acre's UFO
SCP-195-PT - Special Gift for Naughty Workers
SCP-196-PT - Midas Gloves
SCP-199-PT - Spread the Word
SCP-033-PT-EX - Dream-Catcher
SCP-019-PT-J - The Big Ban Hammer
SCP-045-PT-J - Monsterwave
SCP-075-PT-J - Good Morning!
SCP-109-PT-J - The Foundation
SCP-005-PT-ARC - The Reason Why Dendrophobia Exists
SCP-012-PT-ARC - Socrates

Чешский филиал

SCP-017-CS - Absolute Justice
SCP-023-CS - Why can't he just leave me alone?
SCP-042-CS - Northern Devil
SCP-073-CS - The cousin of Winnie the Pooh
SCP-082-CS - Captive of a frequency
SCP-087-CS - Splendid Light
SCP-148-CS - Unfinished Business

Традиционный Китайский филиал

SCP-ZH-002 - Taiwanese Unicorn
SCP-ZH-003 - Extreme Religion
SCP-ZH-004 - Marslow’s Daughter
SCP-ZH-005 - If you haven't re-shared this article with ten friends, then…
SCP-ZH-006 - The real meaning of popcorn
SCP-ZH-037 - Tears from Hawksbill Sea Turtle
SCP-ZH-038 - The Faceless Model
SCP-ZH-041 - Dreams
SCP-ZH-048 - Sword & Sorcery and Tea & Magic Hands
SCP-ZH-060 - The Deer Road Tunnel
SCP-ZH-105 - The Unfilials
SCP-ZH-132 - The 007 Game That Kills You
SCP-ZH-178 - The Bird Mug
SCP-ZH-200 - Let's Tag
SCP-ZH-228 - Tsuipu, 1947
SCP-ZH-236 - Last Year Syndrome (Senioritis)
SCP-ZH-251 - Ruins In Third Floor
SCP-ZH-261 - Cuban Sugar
SCP-ZH-282 - The Gourmet
SCP-ZH-310 - Anomalous Protein Domain
SCP-ZH-446 - Became Bug
SCP-ZH-526 - I’m Just a Toaster
SCP-ZH-545 - I'm Not A Dinosaur
SCP-ZH-617 - The Brave One From the West
SCP-ZH-618 - Sun Pastry Lion
SCP-ZH-736 - You Can't Go Any Further
Mrs. Alicia
SCP-ZH-860 - dado's Hair/Have-fortune Drug
SCP-ZH-889 - Beyond This World
SCP-ZH-973 - As Your Hatred
SCP-ZH-2005-EX - Internet Celebrity
SCP-ZH-9288-EX - You are completely aware that you will never meet the person sitting next to you listening to your story ever again.
SCP-ZH-00l - SCP-ZH-001
SCP-ZH-60053-J - HONK

Вьетнамский филиал

SCP-002-VN - Funeral
SCP-006-VN - The Night Stars
SCP-012-VN - One Gains, What One Wishes
SCP-013-VN - Poisonous Milk
SCP-014-VN - Dream Crayons™
SCP-018-VN - The Two-Wheeled Hatred
SCP-024-VN - The Beginning of All
SCP-033-VN - Rubber Duck
SCP-036-VN - The Cube
SCP-040-VN - Those Black Words
SCP-096-VN - Where the Earth Meets the Tide
SCP-099-VN - The Waifu Heaven
SCP-100-VN-J - The True Omnipotent SCP
SCP-6789-VN-J - A Kettle-Class Loudspeaker

Структурные: публичный_черновик

версия страницы: 7, Последняя правка: 23 Авг. 2023, 15:28 (450 дней назад)

SCP Foundation

Russian Branch

Список доступных тегов